Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Thermotogales

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM1590 infC -213 46 AAAGCAAGTGGAGGCCAGCCCGGCTTCCCACCCTGGGGCAAGAGGCTACCAGGGTAAATATCCCTGAAAGATTCAGCTTCAAGGGGAAGCGGGCTTTTTGCCCGCTATTTTTTATGACTGA
Thermotoga sp. RQ2
TRQ2_1253 infC -213 46 AAAGCAAGTGGAGGCCAGCCCGGCTTCCCACCCTGGGGCAAGAGGCTACCAGGGTAAATATCCCTGAAAGATTCAGCTTCAAGGGGAAGCGGGCTTTTTGCCCGCTATTTTTTATGACTGA
Thermotoga neapolitana DSM 4359
CTN_0869 infC -115 44.2 TAAAAGCAAGTGGAGGCCAGCCCGGCTTCCCACCCTGGAGCAGAAGGCTACCAGGGTAAATATCCCTGAGAACATCAGCTTCAAAGGGAAGCGGGCTTTTTGCCCGCTATTTTTTGTGAAG
Thermotoga petrophila RKU-1
Tpet_1203 infC -197 44.1 AAAAAGCAAGTGGAGGCCAGCCCGGCTTCCCACCCTGGAGCAGGAGGCTACCAGGGTAAATATCCCTGAAAGATTCAGCTTCGAGGGGAAGCGGGCTTTTTGCCCGCTATTTTTTATAGTG
Thermotoga naphthophila RKU-10
Tnap_1218 infC -137 46 AAAAAGCAAGTGGAGGCCAGCCCGGCTTCCCACCCTGGGGCAAGAGGCTACCAGGGTAAATATCCCTGAAAGATTCAGCTTCAAGGGGAAGCGGGCTTTTTGCCCGCTATTTTTTATGACT
Thermotoga lettingae TMO
Tlet_1347 infC -84 32 AGAGCAAGAGGAAGCCTTGCTTCCCACCCCGAGACAGAGTCGAAGGGGTTTAAAAAAAATCAGGCCGTAATGGGAGGCGGGCGTTTGCCCGCATATTTTTTTAATAAG
Thermosipho africanus TCF52B
THA_1200 infC -233 46.4 TATAGTAAAGAGGAAGCGCCCGCTTCCCACCCCAAGCGAAAGCGAAGGGGTTATAAAGCAGTAAACGAGGTTTTAGATTAACATTAATAGATGATTAATGTATCGGCGGGCGTTTTGCACGCCGATATTTTTTATGTTAG
Thermosipho melanesiensis BI429
Tmel_0923 infC -225 38.4 TTTTGAAGAGGAAGCGCCCGCTTCCCACCCCAAGCAAAAGTGCGAAGGGGTAGATAGAGCAGGAAATTATATTTGAGGTTAGAAGGAAAATATATGTCGGCGGGCGTTTTTACTCGCCGATAATTTTTTTAGGAGGG
Fervidobacterium nodosum Rt17-B1
Fnod_0660 infC -172 44.2 GTAAAAAGTGGAGGCGCCCGGCTTCCCACCCAACGGCAAAATGCTGTTTGGGTATCAGAAAAGTTAAGTTTGAAAGGTAGAACTGTGATAAATCATAATGTGTTATAAAACAACGGGCGCTTTTGCCCGTTTTTATTTTTTGAAAA
Petrotoga mobilis SJ95
Pmob_0709 infC -177 27.8 AGGTAAAGAGGAAGTCGCCCGTAGTTAACTTCCCACCCCGGGGAACAATCAAAACCGTCAGGGGTACGAATTTTGAAAAAAATGACTCTTTGGTTAGGAAAAGAGAGTTATTTGTGTTTAAGAAGAAATGGGTGACGATCCGTCACCCATTTTTTATATGTTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD