Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Staphylococcaceae

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1504 infC -164 86 ACGAACCAAGTAGAAGCACCCGCTTCTCACCTGTAGCGACGCATAAAGCAGTTGGCAGGTTAATCACATTACACATAACTGTGTATAAGGAAGAGCGGGTATTTTATACCTGCTCTTCCTTTTTGCT
Staphylococcus capitis SK14
STACA0001_2347 infC -150 81.6 GAACCAAGTAGAAGCACCCGCTTCTCACCTGTAGCGACGCAATAGCAGTTGGCAGGTTAATCATGTTACACAATAAATGTGTGGAAGAAGAGCGGGTATTGTTACTCGCTCTTCTTTTTTGCTTG
Staphylococcus epidermidis ATCC 12228
SE1355 infC -151 79.2 ACGAACCAAGTAGAAGCACCCGCTTCTCACCTGTGGCGACGCTGAAGCAGTTGGCAGGTCAATCATGTTACACATTTATTGTGTCTAAGAAGAGCGGGTAGTTATACTCGCTCTTCTTTTTGCTT
Staphylococcus carnosus subsp. carnosus TM300
Sca_1286 infC -163 74 ACGAACCAAGTAGAAGCTTCCCGCTTCTCACCTGTAGCGACGCATCATAGCTGTTGGCAGGTCCAATACAACGTGATAATCTAATCATGTTGACTAATGGAAAAAGAGCGGGCACTTCTGTGCCCGCTCTTTTTACTTGGG
Staphylococcus haemolyticus JCSC1435
SH1245 infC -83 79.8 GTACCAAGTAGAAACACCCGTTTCTCACCTGTAGCGACGCATCAAGCAGTTGGCAGGTTAATCATGTCACACATTATATGTGTATGAGAGAAGAGCGGGCATTCTATGCTCGCTCTTTTTGCTTGGAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1084 infC -152 86.2 GAACCAAGTAGAAGCTCCCGCTTCTCACCTGTTGCGACGCTATAGGCAGTTGGCAGGTCTTATATATACATGTTAATTTCATGTGTAGAGAAGAGCGGGTATATTATATACTCGCTCTTTTTGCTTGGGAT
Macrococcus caseolyticus JCSC5402
MCCL_1345 infC -144 69.6 AACGGACAAGTAGAAGCATCCCGCTTCTCGCCCTGAAGACGCAATAGCAGTTACAGGGTTAAATAACATGGTTAGACATGTCTATTTTTTAGCGGGTGCATAATGCATTCGCTTTTTTGTTTGTCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD