Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L19_leader in Bacillales

Properties
Regulator family: RF00556
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L19_leader - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU16040 rplS -51 42.4 CGATGTTCCGCTGTGCCGGTTTTTGTGGCCAAGAGCATCTGTT
Bacillus amyloliquefaciens FZB42
RBAM_015870 rplS -61 39.3 CGATGTTCCGCTGTGCCTTGCAGTTGTGGCCAAGAGCATCTGTT
Bacillus pumilus SAFR-032
BPUM_1502 rplS -60 33.2 CGATGTTCCGCTGCAATGAAGAAAGAGGACATGAGCATCTGTT
Bacillus licheniformis DSM 13
BLi01824 rplS -60 43.7 CGATGTTCCGCTGTGCCGGTTAACTCGCGCAAGAGCATCTGTT
Anoxybacillus flavithermus WK1
Aflv_1759 rplS -36 35.9 AACGATGTTCCGCTGCTATGAACGATACACATAAGCATGAGCATCTG
Geobacillus kaustophilus HTA426
GK1202 rplS -58 43 CGATGTTCCGCTGCAATGAAGAGATCATTGGCATGAACATCTGTG
Bacillus cereus ATCC 14579
BC3838 rplS -65 40.1 AACGATGTTCCGCTGTAATTTATTAAGACTTTATAAGAGCATCTG
Bacillus halodurans C-125
BH2478 rplS -66 46.4 TACGATGTTCCGCTGCAGGGGTAGAAGCTGTCATGAGCATCTG
Bacillus clausii KSM-K16
ABC2287 rplS -61 39.3 TACGATATTCCGCTGCTGCAGTGTTGGCATGAATGTCTG
Oceanobacillus iheyensis HTE831
OB1537 rplS -57 37.8 CGATGTTCCGCTGTCCCATACTTGTTCATGAGCATTAGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD