Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L19_leader in Staphylococcaceae

Properties
Regulator family: RF00556
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L19_leader - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1084 rplS -61 38.6 CTATGATCCGCTGCTATATATTTGTCGAGGCAAGAACATAGGTT
Staphylococcus capitis SK14
STACA0001_0581 rplS -63 39.3 CACTATGATCCGCTGCTATACTTTTGTCTAGGCAAGAACATAGG
Staphylococcus epidermidis ATCC 12228
SE0916 rplS -61 39.3 CTATGATCCGCTGCTATACTTTTGTCTAGGCAAGAACATAGGTT
Staphylococcus carnosus subsp. carnosus TM300
Sca_0866 rplS -61 37.3 CTATGATCCGCTGCTATTTTGTTGTCAAGGCAAGAACATAGGTT
Staphylococcus haemolyticus JCSC1435
SH1673 rplS -62 38.7 CACTATGATCCGCTGCTATATGAATGTCTAGGCAAGAACATAGG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1526 rplS -62 38.8 CACTATGATCCGCTGCTATATTTTGTCGAGGCAAGAACATAGG
Macrococcus caseolyticus JCSC5402
MCCL_0824 rplS -52 29.6 CTATGATCCGCTGAGCGAAGACTTAAGAACATAGGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD