Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L13_leader in Bacillales

Properties
Regulator family: RF00555
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L13_leader - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU01490 rplM -104 55.8 GTATGTATTTCAACCCCACGATAAGCCCCGGAACTTATTGTGTTGTGAAATAGAACGT
Bacillus amyloliquefaciens FZB42
RBAM_001740 rplM -104 55.8 GTATGTATTTCAACCCCACGATAAGCCCCGGAACTTATTGTGTTGTGAAATAGAACGT
Bacillus pumilus SAFR-032
BPUM_0136 rplM -111 48.1 GTATGTATTTCAACCCCACAAATAAGCCCCGGAAGACTTATCTTGTGTTTTGAAATAGAACGT
Bacillus licheniformis DSM 13
BLi00167 rplM -105 60.8 GTATGTATTTCAACCCCACGATAAGCCCCGGAAACTTATTGTGTTTTGAAATAGAACGT
Anoxybacillus flavithermus WK1
Aflv_0138 rplM -91 44.8 GTATGTATTTTAAACCCACGATTAGCCCCGGAAATTAATCGTGTTGAAATAAATATC
Geobacillus kaustophilus HTA426
GK0139 rplM -94 27.4 GCATGTATTTTCCACGATTAGCCCCGGACCATAATCGTGTTGAAATAAACGAC
Bacillus cereus ATCC 14579
BC0164 rplM -97 36.4 GTATTGTTTCTAAAACCACGATTAGCCCCGGAAGGAAATCGTGTTTAAGATAAACAATAGAT
Oceanobacillus iheyensis HTE831
OB0151 rplM -106 41.9 GCATTTTATTTCTAAACCATGATTAGCCCCGGAATCTAATTATGTTAGAATATAAATATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD