Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L13_leader in Staphylococcaceae

Properties
Regulator family: RF00555
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L13_leader - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA2017 rplM -198 57 CGGTATTGTTTTATATCCACCCCACGATAAGCCCCGGAAACTTATTGTGTTACAAGATATATAAGCAGAAA
Staphylococcus capitis SK14
STACA0001_1277 rplM -211 55 GTTTTATATCACCCCACGATAAGCCCCGGAAACTTATTGTGTTACTAGATATATAAGCA
Staphylococcus epidermidis ATCC 12228
SE1791 rplM -214 55.9 TTGTTTTATATCACCCCACGATAAGCCCCGGAAACTTATTGTGTTACAAGATATATAAG
Staphylococcus carnosus subsp. carnosus TM300
Sca_1703 rplM -173 52.1 CGGTATTGTTTTATATCACCACCACGATAAGCCCCGGAAACTTATTGTGTTACTAGATATAGAAGCA
Staphylococcus haemolyticus JCSC1435
SH0835 rplM -209 51.6 GTATTGTTTTATATCCACCCCATGATAAGCCCCGGAAACTTATTGTGTTACAAGATATATAAGCAAATTAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0695 rplM -161 50.2 GTATTGTTTTATATCACCCACGATAAGCCCCGGAATCTTATTGTGTAACACGATATAGAAGCACG
Macrococcus caseolyticus JCSC5402
MCCL_0227 rplM -106 41.3 GTATTGTTTAATATCAACCACGACAATAAGCCCCGGAAACTTATTGTGTTACAGATATATAGACAGGATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD