Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Corynebacteriaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium glutamicum ATCC 13032
cg0572 rplJ -224 25.1 ATCGAGCTCAAGGTTCACCGAAGACCGTAGGTCATCCGCATGACGGATCGAAGGTTTCCTACCCTTAGGAACGGCCCACGCAGGAGACACTTGAACGCCTTAGATTCCTTATGTGGAATGTATAGCGCCCTGTGCTCTTGCACGGGGCTTTTCTCATTGGTTTAT
Corynebacterium efficiens YS-314
CE0493 rplJ -239 18.3 GTTGTATTCAAGGTTCACCGAAGACCGTTGGTCATCCGCTGTCGCGGATCGAAGGTTTCCACACTGTTGGAACGGCCCACGCAGGAGACACTTTGACGCCTTAGGTTCCCTTACGTGGAATATGATGCGCCCTGTGCTCTTGCACGGGGCTTTTTTCGTGAGCTGATC
Corynebacterium diphtheriae NCTC 13129
DIP0436 rplJ -219 35.7 AATGATTTCAAGTTTCACCGAAGACCGTCGGTCAGCCATTAGGGCTCGAAGGATTCCCACGCGGAACGGCCCACGCAGGAGACACTGAAGAGTTCACAATCCTTTCGGATTATGTGCGCCTCGTGCTCTTGCACGAGGCTTTTTTGTTGGCTGATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD