Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Cyanobacteria

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Synechococcus sp. PCC 7002
SYNPCC7002_A1027 rplJ -193 62.4 TAAATAGATTTTATTCATGCCAGAGACAGCAGGGGCGATCGCTTAATATCCTGCCGAGGTAAAACGCTACAAGACTAAACAAGTTTTTTTCCAAGTTTGCTTGGAAGAAGAGCGTGACCCTGGCATTGTCGCTGGGGTCTATTTTTTTGTCCCT
Synechocystis sp. PCC 6803
sll1745 rplJ -213 66.5 ATTTATTTAACTGGCTATGCCAAAGACCGCAGGAGCAATTAGGGTTGCTTAATTAACCTGCCGAGGTTGAAGCCTGAATCAAGATTTGAGTTTGTTGGGGATTTGCTTCCTTGACAGCTTTTGATCCTCTGCTTCAGCCCCGGCGATCGCCAAGGGGCATTTTTATTGTGTGT
Cyanothece sp. ATCC 51142
cce_0224 rplJ -196 69.2 AAATAAACTTTGGTTTATGCCGAAGACAGCAGGAGCAGAACTTGCTTAAATATCCTGCCGAGGTTGAAGCCTGAAGCCATAAAACCCAGAAAAATAGTAGGTTTTGCCAACTATTTTTGTGATGGGATT
Cyanothece sp. PCC 8801
PCC8801_1738 rplJ -216 49.1 AATGCTTGTTTGGCTTACGCCGTAGACAGCAGGGGCAATTTGCTTAATGTCCTGCCGAGGTTGAGGCCTGATGAAAGGTAAACAATAGGGAGAAAAAGGGACTTTAGTCTGCTTTTTTGTCCTGTGT
Cyanothece sp. PCC 7425
Cyan7425_4011 rplJ -200 61.6 ACACAACTGAATCAAAAAGCCGCAGACCGCAGGTGCATTTGCTTAAATATCCTGCCGAGGTTTTACACCCTAAAGCAACGAAAAGTTGAAGCTATATAGCCTTTTCAGTTGTTGCTGTAAGACCCCGCCTGCCCTGGTTGGGGTTTTTATTTTCCCGGA
Microcystis aeruginosa NIES-843
MAE_43870 rplJ -215 43.4 TGAGGGACTGGCTTAAGCCAAAGACAGCAGGTGCGAAACAGCTTAAATACCCTGCCGAGGTCAAAGCGAGAAAACAGCAGCCAAAAAGACTAAAGAGAGATATTTTCTGTCTTGGTCGTGCCTGAACTGGATTCTCTCCACTCAACCCCGGCGCTACAAGGGGTTATTTTTGTGCCTGTGG
Nostoc sp. PCC 7120
alr5302 rplJ -225 73.4 AAACTAAATATGCAAAGCCGGAGACAGCAGGTGCTAACAGCTTAAACACCCTGCCGAGGTAAAAGCTCTCTTACTCAATGTGACGTGAAAAATAATGCGTCGCTTTAGTAATCAGAGTCTTGAGACTAAACCCCGGCTGAGATAGTCGGGGTTTATTGTTGTACCCTG
Synechococcus elongatus PCC 7942
Synpcc7942_0632 rplJ -183 69.6 TTGTAACTAAATAGCATTGCCAGAGACAGCAGGTGTTGCACCGCAACTGAAGCATCCTGCCGAGGTAGTCCCCACAGTCTTCGTACTGTTGATCTATTTCGCTCTGGCAACCGAATTTGCCGGAGCTTTTTTGTTGCAAGA
Synechococcus sp. JA-3-3Ab
CYA_1782 rplJ -228 60.5 CACAGTCGAATAGCGAGCCGAAGACAGCAGGGGCCAAGGGGCTTAATGTCCTGCCGAGGTTTGAGCGGAGTGCTAAGGGATCCCGTTGTGGACTGCTAGGTTACGCTTGTCTCAATGCGTCTCGGCTATGGCTGAGGCGCATTCTCTTTGGCGGCTC
Gloeobacter violaceus PCC 7421
gvip225 rplJ -160 65.9 TTCAACCGAATCCGCGACCGAAGACAGCAGGGGCCTTGACGCTTAATCAGCCTGCCGAGGTTGGCACATGGGAAGTACGCCTCCAGGCTTTTTCCCTTTGCGCCTCGCTTCGAATATCGGCGGGGCGATTTTTTTGCCCAACCCA
Thermosynechococcus elongatus BP-1
tlr0297 rplJ -150 60 ACAACTCAAGACTAAAACCGAAGACCGCAGGGGTCTGGCTGAGACATAATCTTCCTGCCGAGGTTTGCGAAGTCCATCCGTTGCGATTGGGCGATCGCCCCGGCACCCTTGCTGGGGTTTTTCTTTCACTGACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD