Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Bacillales

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU01040 rplJ -205 89.5 ATAGAATATCATTTATACCGTAGACAGTAGGGGCCTAACCGCTTAATTATCCTACCGAGGTGTATATTATCACAGCTATTACGTTACGTATGCTTGTATATACAGCCTCCATGTCTCATGGAGGCTTTTTATATGGAATCCG
Bacillus amyloliquefaciens FZB42
RBAM_001290 rplJ -205 94.1 ATAATATGTCATTTATACCGTAGACAGCAGGGGCCGTTAAGGCTTAATATCCTGCCGAGGTGTATATATATCACAGCTATTACGTTACGTATGCTTGTATATACAGCCTCCATGTCCACATGGAGGCTTTTTATATGAAATCGT
Bacillus pumilus SAFR-032
BPUM_0089 rplJ -209 76.1 GAATATGTCCATTTATACCGTAGACAGCAGGGGCCTTATGGCTTAATTAACCCGCCGAGGTGTATATGTCACAGTCTTACGTTAACGTATGCTTGTATATACAGCCTCCATGTCTTATTGGAGGCTTTTTATATGGAGAACC
Bacillus licheniformis DSM 13
BLi00122 rplJ -210 84 AAATATGTCCATTTATACCGTAGACAGTAGGTGCTGATAAGGCTTAATTTCCTACCGAGGTGTATATATATCACAGCTCTAGCGTTACGTATGCTTGTATATACAGCCTCCATGTCGAATGGAGGCTTTTTATATGGAACATG
Anoxybacillus flavithermus WK1
Aflv_0094 rplJ -134 83 AGCGAATATCATTTGTACCGTAGACAGTAGGTGCCTCATATAGGCTTAATTTCCTACCGAGGTGTTGAGACTCATAAATAAGTGCATCTTGCACTTTTCGGGGGCCTCCATGTCTGCGTTGACATGGAGGTTTTTTGATTGAACGGT
Geobacillus kaustophilus HTA426
GK0095 rplJ -210 80.9 AATGAATATCATTTGTACCGTAGACAGTAGGTGCCTGTTTGAGGCTTAATTTCCTACCGAGGTATGTGGACGATAGAACAGCGCGCCCTGCGTCGGGGACGAGCGGCGGTGCGTTGAACGACACCTCCATGTCTACGCGGCATGGAGGTTTTTTATTGAGCAGAC
Bacillus cereus ATCC 14579
BC0119 rplJ -183 78.6 TGAATTTAATTAGTGTACCGTAGACAGTAGGTGTCAATAGACTTAATTTCCTACCCAGGTGTTAATATACGAAGCGGAATCTTTTTTCTGTGACTATATGCCTCCATGTCTACAAGTTGGGCATGGAGGTTTTTAGTGCACTTTCG
Bacillus halodurans C-125
BH0121 rplJ -178 83.6 ACAGGCGTTGAAACATACCGTAGACAGTAGGTGCGTGATTCGCTTAATTTCCTACCGAGGTAAGCAAATAGATGAAAGTCTTTTGACTGGACTCGTATGCCCTCATGTCTGCATGGGGGCATTTTCGTTGGCCTCTT
Bacillus clausii KSM-K16
ABC0139 rplJ -175 86 GAAATAGAATAGTCATACCGTAGACAGCAGGTGCTTCATAGCTTAAATATCCTGCCGAGGTGAGCGAATAGATCTCTTTTTACTAGAGCTTAAAGCCCTCGTGTGTCTTCGTGCCACGAGGGCTTTTCTATGGAAACTCA
Oceanobacillus iheyensis HTE831
OB0109 rplJ -219 86.1 AAAAAGAATACGTTATACCGTAGACAGCGGGGGCTTTATAGCTTAATAATCCTGCCGAGGTGTTTATGATGAAGGTAGTTTCGCGTTAAAAGCATTGCTATCTGCCATATATAAGCTCTCATGTCTACATGGGAGCTTTTTACATTTCTTACT
Paenibacillus sp. JDR-2
Pjdr2_5694 rplJ -214 68.4 TAACATTCGAATACGCATACCGTAGACAGTAGGTGCCGCAAGGCTTAATTTCCTACCGAGGTGTTATGATAAATACAGCTTGCGCGTGATTAACTTCACGGCAGCGATATATCATGGCCTTCGCAGTCGCTGTGGAGGCCTTTCTCATGCACCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD