Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Thermotogales

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0456 rplJ -133 36.7 GAAAACTCAATAAGACGCCGTAGATGGCAGGGCCCGTGGGGTTAAAGATCCTGCCGGAGGCGTCCCAGAAAGGTTCTATGACCTTTTTGTGGACCCTCCGGGGTCCACAAAATTTTTTTGGGAGGTGA
Thermotoga sp. RQ2
TRQ2_0479 rplJ -136 40.2 TCGAAAACTCAATAAGACGCCGTAGATGGCAGGGCCCTTGGGGTTAAAGATCCTGCCGGAGGCGTCCCAGAAAGGTTCTATGACCTTTTTGTGGACCCTCCGGGGTCCACAAAATTTTTTTTGGGAGG
Thermotoga neapolitana DSM 4359
CTN_0217 rplJ -137 32.3 AACAAATAGCCGAGCGACGCCGTAGATGGCAGGTCCCTTTCCGGGTTAAACATCCTGCCGGAGGCGTCCCAAAAGGGCACTAAGGCCTTTTTGTGGACCCTCCGGGGTCCACAAAATTTTTTTGGGAGGT
Thermotoga petrophila RKU-1
Tpet_0464 rplJ -136 40.2 TCGAAAACTCAATAAGACGCCGTAGATGGCAGGGCCCTTGGGGTTAAAGATCCTGCCGGAGGCGTCCCAGAAAGGTTCTATGACCTTTTTGTGGACCCTCCGGGGTCCACAAAATTTTTTTTGGGAGG
Thermotoga naphthophila RKU-10
Tnap_0238 rplJ -134 40.2 GAAAACTCAATAAGACGCCGTAGATGGCAGGGCCCTTGGGGTTAAAGATCCTGCCGGAGGCGTCCCAGAAAGGTTCTATGACCTTTTTGTGGACCCTCCGGGGTCCACAAAATTTTTTTTGGGAGGTG
Thermotoga lettingae TMO
Tlet_0475 rplJ -115 46.6 TGAATAATTGCTTTTCGCCAAAGACAGTAGGTCTATGCTGAAAAAGGGGAGTCCCCGCCTACCGAGGCGAAAGAAACGTTTAATAATATAGTTTCTTTTGCTGCGGGGTCTCTTTTTGAGACCTTTTTTATTGAAAGGAG
Thermosipho africanus TCF52B
THA_1347 rplJ -142 34.2 TGGTAAAATTTAGTCGATGCTGAAGACGGCAGGTTAAATAAAGGCTTATGCCGCCTGCCCGAGGCAGAATGGGAAATATTATTTTCCCATTTGTTGTTGCCTCGGAGTTCCGAGGTTTATTTTTTTGTAG
Thermosipho melanesiensis BI429
Tmel_0504 rplJ -141 33.9 TGTTAAAATCTAACCAGTGCTGAAGACGGCAGGTTAAATAAAGGCAGAAAGCCGCCTGCCCGAGGCAGAAAGGAAAGTGGTTGCTTTCCTTTTTTGCGCCTCGGTATTCCGAGGTTTATTTTTTTGTAGGA
Fervidobacterium nodosum Rt17-B1
Fnod_1784 rplJ -163 25.1 TGGTATATCTCAATGTTTGCCGAAGAATGCAGGTACAAAAAAGACCCAAGTGGTCGCCTGCAGGAGGCACAAAAGAGAAACCCGCTTTTTAGCTGGAGTTCTCTTTTGTTATGCCTCGGAAAGAGGCATTTTTTGTTTTTATT
Petrotoga mobilis SJ95
Pmob_0357 rplJ -151 42.5 AGTAATAACAGATTGCGTGCCAATGAAAGTAGGTCTTTAATGGGTTAAAGAGGCGAAATCTCGCCTACCGAGGTACGCGGATAAAGGAATAATTTTTGTTTCTTTTAGCCGCTACCCATTGCGGCTTTTTTATTTAAGGA
Thermotogales bacterium TBF 19.5.1
Kole_1840 rplJ -150 41.2 AAGTGAAAGTGAATATGTACCGAAGACAGTAGGTTTCTAAAGGTTTTCCATACCGCCTACCGAGGTACGCGGAAAAGATTGAAAGAATAATTTTTCACATATTTCTGCGGCCTCAATGGCCGCTTTTTTTGAAAGGAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD