Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Staphylococcaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0497 rplJ -183 72.1 TTATTGTGATTATTTTACCTAAGACAGTAGGAGTTATTTATAACTTAAAATTTATCCTGCCGAGGCTAAAATTGACTTGAACGTGATGATCTATGATCTTTCAAGCACTTTTTGCCGTGGGTAGAAAGTGCTTTTTTTATTAATTTTA
Staphylococcus capitis SK14
STACA0001_0494 rplJ -187 79.7 ATTAATTGTGATTATTTTACCTAAGACAGTAGGAGTTATTTATAACTTAAAACTCATCCTACCGAGGCTAAAATTGACTTGAACGTGATGATTAATGATCTTTCAAGCACTTTTTGCCGTGGGTAGAAAGTGCTTTTTTTATTGCTAT
Staphylococcus epidermidis ATCC 12228
SE0303 rplJ -186 78.4 TACTTGTGATTATTTTACCTAAGACAGTAGGAGTTATTAATAACTTAAAACAGTATCCTACCGAGGCTAAAATTGACTTGAACGTGATGATTAATGATCTTTCAAGCACTTTTTGCCGTGGGTAGAAAGTGCTTTTTTTATTGTGATTA
Staphylococcus carnosus subsp. carnosus TM300
Sca_0195 rplJ -195 69.7 TTAATGTGATTATTTTACCTAAGACAGTAGGAGTTAAGAAATAACTTAAAAATTATATCCTACCGAGGCTAAAATTGACTTGAACGTGGTTTGTAAAAAACTTTCAAGCACTTTTTGCCGTGGGGTGAAAGTGCTTTTTTTATTGGATTCA
Staphylococcus haemolyticus JCSC1435
SH2468 rplJ -191 71.3 ATTTATTGTGATTATTTTACCTAAGACAGTAGGAGTTATAGTATAACTTAAAAATTATCCTGCCGAGGCTAAAATTGACTTGAACGTGTGATCATAAAAATGATCTTTCAAGCGCTTTTTGCCGTGGGTAGAAAGTGCTTTTTTTATTGAGAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP2216 rplJ -227 73.6 TGGTTAATGTATTATTTTACCTAAGACAGTAGGAGTTAGTAATAACTTAAAATTTGATCCTACCGAGGCTAAAATTGACTTGAACGTGAAGATTTTAGATCTTTCAAGCACTTTTTGCCGTGGGTAGAAAGTGTTTTTTTTATTGGATA
Macrococcus caseolyticus JCSC5402
MCCL_1869 rplJ -164 74.3 ATTTGTATTTTATAAATAACCTAAGACAGTAGGGGCATCAAGCTTAATAATCCTACCGAGGTGAAATTTGACTTGAACATTTCAAGCACTTTTTGCCATGGGTGAAAAGTGCTTTTTTAATATTCTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD