Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator His_leader in Enterobacteriales

Properties
Regulator family: RF00514
Regulation mode:
Biological process: Histidine biosynthesis
Effector:
Regulog: His_leader - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b2019 hisG -169 129.5 CATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGATCACCTTCCGGGGGCTTTTTTATTG
Salmonella typhimurium LT2
STM2071 hisG -170 130.6 CATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGATCATCTTCCGGGGGCTTTTTTTTTG
Citrobacter koseri ATCC BAA-895
CKO_00766 hisG -82 126.6 ACCATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGATCATTCTTCCGGGGGCTTTTTTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_02475 hisG -169 116.3 CATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACGTTTGGATCTTCCAGTGGTGCATGAACGCGCAGAGAGCCCCCGGAAGATTCACTTCCGGGGGCTTTTTTTTGG
Enterobacter sp. 638
Ent638_2631 hisG -168 128.5 CATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCCAGTGGTGCGAGAACGCAAGAGAAAGCCCCCGGAAGATGATCTTCCGGGGGCTTTTTTTTGG
Erwinia amylovora ATCC 49946
EAM_2141 hisG -191 110.4 CATCACCACCATCACCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGGATCTTCCAGCGGTGCAGAACGCAAAATCAGCCCCCGGAAGATCGCCTTCCGGGGGCTTTTTTTTTG
Yersinia pestis KIM
y2620 hisG -306 112.8 CATCACCACCATCATCCTGACTAGTCTTACAGGCCGATGTGTGCTGGAAGACGGTTAACGAATCTTCCAGGTGGCGTAGAGAACGCAGTAGAGAGCCCTCGGAAGATAATCTTCCGAGGGCTTTTTTATTG
Serratia proteamaculans 568
Spro_1616 hisG -198 111 ACCATCATCACCATCACCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACGGTTTTTTAATCTTCCAGTGGCGCGCAGAATGCAAGAGAGAGCCCTCGGAAGATTTCTTCCGAGGGTTTTTTTTT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA2582 hisG -170 103.3 CATCATCACCATCATCCTGATTAGTCTTTCGGACGGTTGGTGCTGGAAGACGTTCAGATCTTCCAGTGGCGCAGAACACAAAGAGAGCCCTCGGAAGATCATCTTCCGAGGGTTTTTTTATGC
Edwardsiella tarda EIB202
ETAE_2275 hisG -187 106.2 CATCATCACCATCATCCTGACTAGCGCTTTCAGGCGGATGTGTGCTGGAAGACGGTCAACGGATCTTCCAGTGGCGGCAGACGCAAGATGTGAAAAAGCCCTCGGAAGATCTTCTTCCGAGGGCTTTTTTGTTG
Proteus mirabilis HI4320
PMI0665 hisG -177 101.7 ACCATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGAGTGCTGGAAGACGTTTAGGTAACGCTTCCGGTGGTCTGAGTGCAGACAATAAAATAAAAACCCCGGAAGGCAACTTCCGGGGTTTTTTTATA
Photorhabdus luminescens subsp. laumondii TTO1
plu1570 hisG -139 97.4 ATTACCACCATCATCATCCTGATTAGTCTTTCAGGCGGTTGTGTGCTGGAAGACGTTTAACGGGTCTTCCGGTGGCATGAATGCGATAAAAACCCCCGGAAGGATCCTTCCGGGGGTTTTTTTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD