Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator His_leader in Thermotogales

Properties
Regulator family: RF00514
Regulation mode:
Biological process: Histidine biosynthesis
Effector:
Regulog: His_leader - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga lettingae TMO
Tlet_0482 hisJ -130 28.9 TTACAACAGAGGCAGCCCGGTTTTCTTCCCGGGTAGCATCTGTTGTGGTGCTGCTTAAAGGGAAGATAGAGAAAAAACCGGGCTGCTGAAAAGTAGCCCGGTTTTTTTTATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD