Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator His_leader in Shewanellaceae

Properties
Regulator family: RF00514
Regulation mode:
Biological process: Histidine biosynthesis
Effector:
Regulog: His_leader - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_2074 hisG -196 47.3 ACCATCATCACCACCATATGCGGTAGCCTTCGGACGTTCACTGCCGGAGGACTATATCCTTCTGGCGGACTGATTCAAAGATGATCATAAACCCCTGGAAGGAATTCCGGGGGTTTTTGCTT
Shewanella putrefaciens CN-32
Sputcn32_2178 hisG -77 48.9 CACCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGACTATATCCTTCTGGCGGACTGATTCAAGATGATCAAAAACCCCTGGAAGGAATTCCGGGGGTTTTTGCATTT
Shewanella sp W3-18-1
Sputw3181_1831 hisG -79 48.9 TCCACCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGACTATATCCTTCTGGCGGACTGATTCAAGATGATCAAAAACCCCTGGAAGGAATTCCGGGGGTTTTTGCAT
Shewanella sp ANA-3
Shewana3_1854 hisG -271 40.8 ACCATCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGACTGTATCCTTCTGGCGGACTGATTCAAAGATGATCACTAACCCCTGGAAGGAATTCCGGGGGTTTTTGCTT
Shewanella sp MR-4
Shewmr4_1800 hisG -172 40.8 ACCATCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGACTGTATCCTTCTGGCGGACTGATTCAAAGATGATCACTAACCCCTGGAAGGAATTCCGGGGGTTTTTGCTT
Shewanella sp MR-7
Shewmr7_2177 hisG -269 40.8 CATCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGACTGTATCCTTCTGGCGGACTGATTCAAAGATGATCACTAACCCCTGGAAGGAATTCCGGGGGTTTTTGCTTTT
Shewanella baltica OS155
Sbal_2425 hisG -305 41.9 CACCATCACCACCATATGCGGTAGCCTTCGGACGCTCACTGCCGGAGGAGTATATCCTTCTGGCGGACTGATTCAAGATGATCATAAACCCCTGGAAGGAATTCCGGGGGTTTTTTGCATTT
Shewanella denitrificans OS217
Sden_1618 hisG -232 49 TGCACCATCATCACCATATGCGGTAGCCTTCGGATGCTTACTGCCGAAGGACTGTATCCTTCTGGCGGTGATATATTTATATAACACAAAACCCCTGGAAGGAATTTCAGGGGTTTTTTGCT
Shewanella frigidimarina NCIMB 400
Sfri_1720 hisG -180 45.1 TCCACCATCATCACCATATGCGGTAGCCTTCGGATGCTAACTGCCGAAGGACGTTATCCTTCTGGTGGTGAACACTTATTCACATAAACCCCTGGAAGGAATTTCAGGGGTTTTTTGTT
Shewanella amazonensis SB2B
Sama_1941 hisG -171 44.2 CATCATCACCATCATAAGCGGTAGCCTTCGGAAGCTCACTGCCGAAGGTGCATTCCTTCTGGCGGTCATGATCTAAAGTTTCAGGACAACCCCCGGAAGGAATTCCGGGGGTTTTTCTTTGC
Shewanella loihica PV-4
Shew_2197 hisG -188 46.8 CATCATCACCATCATATGCGGTAGCCTTCGGATGCTTACTGCCGGAGGACTATTTCCTTCTGGCGGTTGATTCAAAAGCGATCTAAGACCCCTGGAAGGAATTCCGGGGGTTTTTAGTTTTT
Shewanella pealeana ATCC 700345
Spea_2456 hisG -175 53.8 CATCATCATCACCATATGCGGTAGCCTTCGGAAGCTCACTGCCGAAGGACTATTTCCTTCCGGCGGTTGATTTAAAAATATCAAAAACCCTTGGAAGGAATTCCAAGGGTTTTTTGGTTT
Shewanella halifaxensis HAW-EB4
Shal_1824 hisG -177 58 TGCATCATCATCACCATATGCGGTAGCCTTCGGAAGCTCACTGCCGGAGGACTATTTCCTTCCGGCGGTTGATTTAAAAATATCAAAAACCCTTGGAAGGAATTCCAAGGGTTTTTTGGT
Shewanella piezotolerans WP3
swp_3001 hisG -173 53.3 CATCATCATCACCATATGCGGTAGCCTTCGGAAGCTCACTGCCGAAGGACTGATTCCTTCTGGCGGTTGATTCAAAATATCAAAAACCCCTGGAAGGAATTCCAGGGGTTTTTTGGTTT
Shewanella sediminis HAW-EB3
Ssed_2541 hisG -170 49 CATCATCATCACCATATGCGGTAGCCTTCGGAAGCTCACTGCCGAAGGACTATTTCCTTCCGGCGGTTGATTCAAGAATATCAAGAACCCCTGGAAGGAATTCCGGGGGTTTTTACGTTT
Shewanella woodyi ATCC 51908
Swoo_2092 hisG -207 46.8 TGCATCATCACCACCATATGCGGTAGCCTTCGGAAGCTCACTGCCGAAGGAGACTATCCTTCTGGCGGTTGATTCAAGAATATCAAAACCCCTGGAAGGAATTCCGGGGGTTTTTCGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD