Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU1964/DVU1967 in Desulfovibrionales

Properties
Regulator family: Rrf2
Regulation mode:
Biological process:
Effector:
Regulog: DVU1964/DVU1967 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfomicrobium baculatum DSM 4028
Dbac_3187 Dbac_3187 -17 4.4 AATCATTCGAGATTATTATGAAG
Desulfovibrio desulfuricans G20
Dde_0224 DVU1967 -79 4.7 ATCTAGATAAATTAAATCCGCTT
Dde_0224 DVU1967 -139 5.6 AATCAGACCAAACAAGTCTGGAT
Dde_0224 DVU1967 -94 5.5 ATCCAGACTGTATTAATCTAGAT
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_0843 DVU1967 -77 4.7 ATCATGAGTAAAGCAGTCTAAAT
Ddes_0843 DVU1967 -57 4.6 AATTAGACGTATCAAGTATGGTA
Ddes_1846 null -196 4.8 AAACATACTAGTTTAGTATTAAT
Desulfovibrio salexigens DSM 2638
Desal_0350 null -585 5.6 ATTCAGATTAATTTAATCCGAAT
Desal_0350 null -570 4.8 ATCCGAATTAAAACAATCTGAAT
Desal_0350 null -491 5.2 TTCTAGACTTATTTAATCTAGAT
Desal_0350 null -476 5.1 ATCTAGATTAAAACAATCAGAAA
Desal_0351 Dbac_3187 -269 4.1 TTAAATATCAACGCAATATGTAG
Desulfovibrio vulgaris Hildenborough
DVU1967 DVU1967 -104 5.8 ATTCAGACCAACTCAATCTGATA
DVU1967 DVU1967 -84 4.8 ATACAGATTAATTAAGATTGAAA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_0623 DVU1967 -155 5.9 ATTCATACGAAATTAATCTGATT
DvMF_0623 DVU1967 -110 4.1 AACGAAATTGCATCAATATACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD