Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Cyanobacteria

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cyanothece sp. PCC 7425
Cyan7425_5453 null -340 33.3 AGTCCCGAAAAGGCAACTTACTCCGAAAGGGTAAGGCGCAAATTGGTAATCCTGTAGCCAAGGTGCCGGTATGGATGTGCCAATGCCGAA
Cyan7425_0305 null -340 36.1 AGTCCCGAAAAGGCAACTTGCTCCGAAAGGGTAAGACGCAAATTGGTAATCCTGTAGCCAGGGTGTCGGTATGGATGTGTCAATGCCGAA
Cyan7425_5459 null -301 32.8 AGTCCCGAAAAAGCAACTTACTCCGAAAGGGTAGGGCGCAAATTGGTAAGCCTGCAGCCAGGGTATCGGTATGGCTGTGCCAATGCCGAA
Cyan7425_0032 null -431 35.8 TCCCGAAAAGGCAACTTGCTCCGAAAGGGTAAGACGCAAATTGGTAATCCTGCAGCCAGGGTGTCGGTATGGATGTGTCAATGCCGAAGG
Cyan7425_2124 null -199 36 TCCCGAAAAGGCAACTTGTTCCGAAAGGACAAGACGCAAATTAGGAGTCCTGTAGCCAACCTTTGATTGCGGTATGGACAGCACTAATGCCGAAGG
Thermosynechococcus elongatus BP-1
tlr0560 null -287 33.7 CCCGATAAAGGTAAGTTACGCCGAAAGGGTAACGCACAAATCAAGGATCCTGTAGCCGCCGCTTCAGAAAAGGGTATGGACGTCCTTGATGCCGAAGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD