Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Enterobacteriales

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_03622 mcp -112 22.8 TTATTGAAAAGGGCAGGAATACGCGCGGCAAGTCGCCGGGCAAAATTAAATATGCCGGCGGCACTGCCGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD