Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Ralstonia

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia pickettii 12J
Rpic_3899 PF12138 -143 45.2 CCAGAGGTCTGGGCAAAACCGGAGTGATCCGGCGACGCAAAGCTACAGGGACTTCTCCAGAAGAAGTCAGCCAGTTGCCCGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD