Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Desulfovibrionales

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio desulfuricans G20
Dde_0820 COG2204 -102 42.7 GAGAATCAAGCCAACCCGCCTCAGGCGGGACGGAAAGCCACGGGTCTTTCAGACAGCCGGGTTGCCTCGGT
Desulfovibrio magneticus RS-1
DMR_38310 mcp 15 31.7 TGCCCAATAACGCCACCCCTGCCGCGAGGCAGGTCCGGAAAGCCGCGGGTCTCGACGGCCGTCGTCGAGACAGCCGGGCCGCTGGG
DMR_29160 null -241 32.3 AAGTCTGTAAAGCCAACCCCGTCGTGAGGCGGGTGCGTACGGAAAGCCACGGGCCTCACGGTTGAGGCAGCCGAGCCGCCATG
Desulfohalobium retbaense DSM 5692
Dret_0342 mcp2 -400 57.8 GGACTGACAAAGCCAAACCCGTCGTGAGGCGAGGACGGAAAGCCACGGGTCTCAATGAGACAGCCGGGTTGCCGGA
Dret_0945 null -292 62.4 ACTGACAAAGCCAAACCCGTCGTGAGGCGGGGACGGAAAGCCACGGGTCTCAATGAGACAGCCGGGTTGCCGGATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD