Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Bacillales

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus pumilus SAFR-032
BPUM_0319 srfAA -232 66.4 GAAGAAAAAGGCAAATCTATGGAAACGTAGAGACGCAAAGCCATGTCCTAAGGTAAATGTTGCTTTTTTACTATGGTCGCCAGGTTACCGAATC
Bacillus licheniformis DSM 13
BLi00401 srfAA -269 69.6 GCAGATAAAGGCAAACCTGCGGAAACGCAGGGACGCAAAGCCATGGCCTAAGGTGCTGACGGTGCTACGGTTGACAGGTTGCCGAATA
Anoxybacillus flavithermus WK1
Aflv_1600 null -65 63.1 TAAGAAGTAAAGGCACAGCTAAGGAAACTTAGCGTCGCAAAGCTATAGGGGCTAACGGGATACCTATGCCAGCCAGCTGCCATT
Aflv_0339 tlpA -190 68 TGAATAATCGGCAAACTACTCGAAAGGGTAGGGCGCAAAGCTATAGGGGCTACGTCTATTTGTAGATATGCCAGCCAGTTGCCCTTCT
Bacillus cereus ATCC 14579
BC1060 null -151 52 GATATTTTTAGCACACTATTCGAAAGGATAGGCCGCAAAGCTTAGAGTCTACGGTAATACATATTGGTTACTAAGATCGTCTGGTTGCACATTT
BC0422 tlpA -218 61 AGCGAGAAAGGCAAACTGATGGAAACATGAGGACGCAAAACTACAGGAGCTAAGGTCGAAAGGCTACGCTAGCCAGTTACCGGACG
Bacillus halodurans C-125
BH0563 BH0563 -202 46 CTTGAAAAAGGCGAGTGTTTGAAATGGAAAGACGCAAAGCTGCGAGTCTGAAATCCTTCTGAATAGGGATAGTCGAGTTGTCAAAAA
Oceanobacillus iheyensis HTE831
OB2524 sinR -315 72.7 CCTCAGAAAAAGGCAAACCTATTGAAAGATGGGGACGCAAAGTCACAGATCTAAGGTATTTTTACTAAGATGGCTGGACTATCTGG
Paenibacillus sp. JDR-2
Pjdr2_3934 tlpA -181 74.4 AAACTGAAAAAGGCAAACTTGCCGAAAGGCAAGGACGCAAAGTTATGGGCCTAATGCTGCATAGAAGCGATGGCTGCCAGACCGCCGGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD