Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Shewanellaceae

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_1072 cbp -221 74.9 ACCGTATTGGGCAAACTAATTGAAAAATTAGGACGCAAAGCCTCCGGTCTAAGGTTGTAAAGGGATGTTAACTAAGATAGCGGGGTTGCTTAAGG
Shewanella sp W3-18-1
Sputw3181_3484 null -167 54.9 ACTGACGAACAGGTACACCCGTTGTGAGACGGGGTCGCAAAGCTTCGGGTCTTGATTTTTTATTAAGATAGCCGGGTTGCCGAA
Shewanella sp ANA-3
Shewana3_2984 null -198 78.7 TTAGTGTAAAAGGCAAACCAATCGAAAGATTGGGACGCAAAGCCTCCGGTCTAAGGGTTCGTTTGTACCTATGATAGCGGGGATACCACA
Shewanella sp MR-4
Shewmr4_3376 null -176 55.2 ACTGACGAACAGGCACACCCGTTGTGAAACGGGGTCGCAAAGCTTCGGATCTTATTGTACAGGCTGTTATTAAGATGGCTGAGTTGCCGAA
Shewmr4_3027 cbp -222 72.8 CCACCGTATTTGGCAAACTAATTGAAAAATTAGGACGCAAAGCCTCCGGTCTAAGGTTGTAAAGGGATGTTGAAACTAAGATAGCGGGGTTGCCTCA
Shewmr4_2805 null -196 76.2 TTATTGTGAAAGGCAAACCAATTGAAAGATTGGGACGCAAAGCCTCCGGTCTAAGGGTCGTTTGTACCTATGATAGCGGGGATACCGCA
Shewanella sp MR-7
Shewmr7_0577 null -174 55.2 TGACGAACAGGCACACCCGTTGTGAAACGGGGTCGCAAAGCTTCGGATCTTATTGTACAGGCTGTTATTAAGATGGCTGAGTTGCCGAATC
Shewmr7_0947 cbp -220 72.8 ACCGTATTTGGCAAACTAATTGAAAAATTAGGACGCAAAGCCTCCGGTCTAAGGTTGTAAAGGGATGTTGAAACTAAGATAGCGGGGTTGCCTGAGA
Shewmr7_2888 null -196 76.2 TTATTGTGAAAGGCAAACCAATTGAAAGATTGGGACGCAAAGCCTCCGGTCTAAGGGTCGTTTGTACCTATGATAGCGGGGATACCGCA
Shewanella baltica OS155
Sbal_3083 null -204 76.1 TGCGTGTAAAAGGCAAACCAGTTGAAAAACTGGGACGCAAAGCCTCCGGTCTAAGGGTTCGTCTGTACCTATGATAGCGGGGATACCACA
Sbal_0896 cbp -221 69.7 ACCGTATTTGGCAAACTAATTGAAAAGTTAGGACGCAAAGCTTCCGGTCTAAGGTTGTAAATGGATTTTTTAGTGAACTAAGATAGCGGAGTTGCCGCAGA
Shewanella denitrificans OS217
Sden_2136 null -194 61.8 GCTGTGGAAGGCAAACCAGTTTTAAAGACTGGGACGCAAAGCCTCCGATCTAAAGGTTTGCTTGTACCTATGATAGCGGGGATCCCACAGG
Shewanella loihica PV-4
Shew_1642 filK -156 63.2 TCTCGAAACGGCAAGCATTAAGTAATTAATGTACGCAAAGCCACAGGCCCTAATTGCATAGCAAAAGGGTGGCTGGGTTACCGAATG
Shewanella pealeana ATCC 700345
Spea_3655 chiA2 -150 69.3 TTGATGAAAAAGGCAAAACCTGTGAAAGCAGGTGACGCAAAGCATCCAGCCTAAGGGGACACCTATGGCAGTGGCGCTACCGCA
Shewanella halifaxensis HAW-EB4
Shal_3479 PF10462 -190 76.9 CAGCGAAAAGGCAAACCAGTTGAAAGACTGGGACGCAAAACCACCGGTCTAAGGGTCAATTGTACCTATGATAGCGGGGATGCCATTGG
Shal_3745 chiA2 -157 70.7 TTGATGAAAAAGGCAAAACCTGTGAAAGCGGGTGACGCAAAGCATCCAGCCTAACGGAGCAACTCCTACGGCAGTGGCGCTACCGCA
Shewanella piezotolerans WP3
swp_0647 null -222 20.1 ATGAAATGAAAGGCAAGCCAATTTATATATTGGTATGCAAGGCCTCTCGGCAAGTGTCCGCCAAG
Shewanella sediminis HAW-EB3
Ssed_3199 null -193 46.6 TACGATAAAGGCAAAACCGGGGTAACCCGGCGACGCAAAACCAGTGCCCAGGCAGAGATGCGGGGGTCGAACGGTTACCGAAAA
Shewanella woodyi ATCC 51908
Swoo_3879 cbp -225 63.4 TCCATGTATTTGGCAAACTAGCTGAAAAGTTAGGACGCAAAGCTTCCGGTCTAAGGTGCAGGACTCACTGAGTGCTCATTAAGATAGCGGGGTTGCCACG
Swoo_1100 null -270 60.8 ATGTACAAAGGCAAACCAATCGAAAGGTTGGGACGCAAAGCTTCCGGTCTAAGGGGATAGTGTTTGAGAGGGTCGCACTCTTAACGTTATTTTGGTACCTATGATAGCGGGGATGTTACAGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD