Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Corynebacteriaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium jeikeium K411
jk0209 gcvP -255 35.3 TAGCTGTGGTGGGAGAGGCTCGGCGCTAGCCACGCGCCGGCCGCCGACGGAGCAATTCCTCCCCAGGACACTCTCAGGCCCCAAGTACCGTCACGGTG
jk0209 gcvP -158 50.5 GAGGCAACTCTGGAAAGACCTGCGCGCAGTCGTGTGCACGCGGGCGCCGAAGGAGAAAAGCCGGGTTGACCGGGTGAAGCTCTCAGGCACAAGCGACAGAGTGGGGAGGGC
Corynebacterium kroppenstedtii DSM 44385
ckrop_0298 gcvP -317 37.9 GAGTTGCAACGGGAGAGCTTGCTTTCCGCGCCGGGCGCATTGTGCTTCCGGCCAGGAAAGTAGCGCCGTAGGAGCAAACCCTCCCCGGGAATCTCTCAGGCCCAGTACCGCTGCAATG
ckrop_0298 gcvP -200 40.8 GAGGCACCACTGGAAAGAGCTGCGTATGCAGCCGCCGAAGGAGAAAAGCAGACCGAAGCAACGCGACCTGTGGGCTCTATAGATTTGTAGGGCTCCATGCAGGGCCAAACACAGCGCGTTGCTAAGGCTGCCGAAGCTCTCAGGTACAGGAGACAGTGCGGGGGAGGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD