Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Enterobacteriales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erwinia carotovora subsp. atroseptica SCRI1043
ECA2334 yicG -118 54.3 ATTGAAGCCAACTGGAGAGAGGTTGCGATGCAACCCACCGAAGGGGCAAGCAGCTCTGCTGCGTAAACTCTCAGGTAAAGCGGACAGAGGGAGTGGC
ECA2334 yicG -249 40 TCCGCTCCTCGCAGGAGAGAGGGCGTGTACTCCAGCATACTTCAAGCTACATGTACGTTGGCATAAAGTATAACGCTCCGCCGAAGGCGCAAACTCCCATAATCGCTCAGGCTACCCTAACTGCGAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD