Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Ralstonia

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RSc3293 gcvT -363 40.7 CCATCCATCCGGGAGAGCGCGTCGGCCGCATACGGCCAGTCGCCGCCGAAGGGGTAGCACCCGAAAACTCTCAGGCATCCAGGACCGGGTGGATCGGCT
RSc3293 gcvT -252 32.8 GGCCGCACTCTGGAGAGCGGCGCCGCGTCACCATCGCGGGCGCCCACCGAAGGGGCTCACGGAACCGTCGCACGCGTTGTGTCGCTTCCCAATCTCTCAGGTACCAAGGACAGAGGGGCCACCCG
Ralstonia pickettii 12J
Rpic_3487 gcvT -366 37.2 CCATCCATCCGGGAGAGCGTGCCCGCCGTACACGGCAAGGCGCCGCCGAAGGGGTAGCACCCGAAAACTCTCAGGCATCCAGGACCGGGCGGATCGGCG
Rpic_3487 gcvT -256 24.2 GACCGCACTCTGGAGAGCTGGCGCCGCACGACCACTGCGGGCGCCCACCGAAGGGGCTCACGAACGGCGCGCACCGCTATGCGCCCCGCTTCGCAATCTCTCAGGTACCAAGGACAGAGGGGCCATCTG
Rpic_4307 dadA -149 43.8 CGACTGCGAATCTGGAGAGAGGCGTGCACGCGCGCGCCCACCGAAGGGGAAGGCGCCAGCGCTGCTGACGCCCAAGCTCTCAGGTCCCAAGACAGATGGGGTGAG
Rpic_4307 dadA -252 51.8 GCAACACGCCGCAGGAGAGACCGGGCTCAACGCACACGCGCGCAACGCCCGGCGCCGATGGAGCAACCACCCCGGAAACTCTCAGGCAAAAGGACTGTGGCGT
Ralstonia metallidurans CH34
Rmet_3480 gcvT -335 48.7 GCATCCGGCCGGGAGAGCGCGCAGCGATTGCGCCGCCGAAGGGGTATCACCCGAAAACTCTCAGGCACCATGGACTGGCTGGATCGGCA
Rmet_3480 gcvT -226 44.2 TGCCGCACTCTGGAGAGCGACATCCGCTATTGCAAGGCAATGGTGAGCATGTCCACCGAAGGGGCGCACGAAGCACCACGCTTCGTAATCTCTCAGGTATCGAGGACAGAGGGGTCATCCG
Rmet_5580 dadA -272 48.6 CGCGTGTATCGGGAGAGTCTGTGCCAGCCGCCCGGCCGACACGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGGTACCCGC
Rmet_5580 dadA -175 42.1 CATTGAACTCTGAAGAACCCCGGCTTGCACGTCAGCCGGCGGTACCGAAGGAGCAAGCGGCACGCGTATTGTTCGTGTGCCGCGAATCTCTCAGGTCAAGGACAGAGGGGGCGTCCG
Ralstonia eutropha JMP134
Reut_A3329 gcvT -329 47 GCATCCGACCGGGAGAGCGCGCACAGTCTTGCGCCGCCGAAGGGGTATCACCCGAAAACTCTCAGGCACCACGGACCGTTCGGATCGGCA
Reut_A3329 gcvT -219 39.2 TGCCGCACTCTGGAGAGCGGCACCCGCCATCAATGGCGAGCGTGCCCACCGAAGGGGCGCGCGAGGATCGGATCCAACGGATCGGCCTCGTAATCTCTCAGGTATCGAGGACAGAGGGGTCATCCG
Reut_B3726 dadA -241 40.3 GCGACCTCGCAGGAGAGACCGGAACGCCGCCAGGCGCGTCCGGCGCCGACGGAGCAACCGCCCCGGAAACTCTCAGGCACACAGGACTGTGGCGTCG
Reut_B3726 dadA -142 46.8 AGTACAGATCTGGAGAGAGGCGCTTTGCGCCCACCGAAGGGGACGGCATGGCCTGGCCATGTCCAAGCTCTCAGGTACCGCGGACAGATGGGGCAGGGG
Ralstonia eutropha H16
H16_A3619 gcvT -332 46 GCATCCGACCGGGAGAGCGCGCATCGCCTGCGCCGCCGAAGGGGTATCACCCGAAAACTCTCAGGCACCACGGACCGATCGGATCGGCA
H16_A3619 gcvT -223 37.5 TGCCGAACTCTGGAGAGCGGCACCCGCCATTCGTGGCGAGCGTGCCCACCGAAGGGGCGCACGAGGACGGGGTCCGGCAGGATCCGCCTTGTAATCTCTCAGGTATCGAGGACAGAGGGGTCATCCG
H16_B0508 dadA -176 35.8 GTCAGTGCACTCTGAAGAATGCCGGACGCTATCGTCCGCCGGCATACCGAAGGAGCAAGCGCGCCCCGCCCTCGCGGCCGGGTGGCGTGAATCTCTCAGGTCCAGAACAGAGGGGGCGTC
H16_B0508 dadA -275 53.6 CAATGTGATGCAGGGAGAGACTGTCGCGGTGCCCGCCGCGGACAGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGGCATCACCAG
Cupriavidus taiwanensis
RALTA_A3074 gcvT -328 49.6 GCATCCGACCGGGAGAGCGCGCATCGCCTGCGCCGCCGAAGGGGTATCACCCGAAAACTCTCAGGCACCACGGACCGGTCGGATCGGCA
RALTA_A3074 gcvT -219 38.3 TGCCGCACTCTGGAGAGCGGCACCCGCCATTCGTGGCGAGCGTGCCCACCGAAGGGGCGCGCGAGGACTGGAATCCGCAGGATCCGCCTCGTAATCTCTCAGGTATCGAGGACAGAGGGGTCATCCG
RALTA_B0324 dadA -178 32.2 GTCAGTGCACTCTGAAGAATGCCGGACGCCATCGTCCGCCCGGCATACCGAAGGAGCAAGCGCGCCCCGCCCCCGCGGCAAGGCGCCGCGAATCTCTCAGGTCCAGAACAGAGGGGGCGTC
RALTA_B0324 dadA -277 44.9 CAGCGTGATGCAGGGAGAGACTGTCGCGGCGCCCGCCGCGCACGGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGGCATCACCCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD