Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Desulfovibrionales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU0724 glyP -231 60.2 GCCTCTGGAGAGACCCCGCAAGGGGCACCGAAGGAGCAAGCCGCCCCATGTGGCGGTGAAACTCTCAGGTAAAAGGACAGAGG
DVU0724 glyP -314 60.6 GATGACGACAGCAGGAGAGACCTCCCCCAGAGGGAGGCGCCGACGAAGTAAATCTTTCAGGCGAAAGGACTGCTGTCCGACG
Desulfovibrio desulfuricans G20
Dde_2852 glyP -341 52.8 TGACGACAGCAGGAGAGATTTCCGCCGTTCCACACCCCCGGACGGAAACGCCGAAGAAGTAAATCTTTCAGGCAAAAGGACTGCTGTTTG
Dde_2852 glyP -252 67.4 GACGAGCCTCTGGAGAGACTCCCCCTGTGGGAGCACCGAAGGAGCAAGCCGGTCGTAGATCTCCTCCACGACCGGTGAAACTCTCAGGTAAAAGGACAGAGGGCCCTTTAT
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_0984 Ddes_0984 -238 61.7 AATGATGACCATGAGAGAGCTTGCTGCTGGACAGCACGCCGAAGGGGCAAGAGCAATCGAAACTCTCAGGCAAAAGGATCATGGTCGGACG
Ddes_0112 grdB -637 53.6 GTTAATGCGTGAGAGAGTCTCCAGCTTTCCAAAAGCTAGGGGCACCGAAGGGGCAAAGCCGCCAGGCCGAAACTCTCAGGTAAAAGAATCGCGCATTCTCGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD