Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Bacillales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU24570 gcvT -177 33.8 TCGACGCAACTCTGGAGAGTGTTTGTGCGGATGCGCAAACCACCAAAGGGGACGTCTTTGCGTATGCAAAGTAAACTTTCAGGTGCCAGGACAGAGAACCTTCA
BSU24570 gcvT -274 60.3 AATGACAGCAAGGGGAGAGACCTGACCGAAAACCTCGGGATACAGGCGCCGAAGGAGCAAACTGCGGAGTGAATCTCTCAGGCAAAAGAACTCTTGCT
Bacillus amyloliquefaciens FZB42
RBAM_022890 gcvT -176 24.8 ACTCTGGAGAGTGTCTGCACTTAGAAGCAGCAGACCACCAAAGGGGACGTCTTTATGATATGTTCATAAAGTAAACTTTCAGGTGCCGGGACAGAG
RBAM_022890 gcvT -280 61.2 AATGACAGCAAGGGGAGAGACTCGGACGAAAGATGGGCGTCCGGGCGCCGAAGGAGCAAACTGCGGAGTGAATCTCTCAGGCAAAAGAACTCTTGCTCGACG
RBAM_036990 ydgF -227 51.6 AGGAGCGGCTTCTGGAGAGACCGCGGGTTTTCCGCGGCGCCGAAGGGTTCACAATCTCAGGCAAAAGGACAGAAGAGTACCG
Bacillus pumilus SAFR-032
BPUM_2189 gcvT -201 35.2 ACTCTGGAGAGTGTTTGCTCATCGTTTTTTAGCAAACCACCAAAGGGGAAAACGCACAATGATGTTGTGCTGTAAACTTTCAGGTGCAAGGACAGAG
BPUM_2189 gcvT -312 62.4 GATGATGGTATGGGGAGAGACTTGGCGGTTATTTAGCACTGGCAGGCGCCGAAGGAGCAAGCTGAATCGTTTCAGTGAATCTCTCAGGCAAAAGTACTCTTACCGGACG
BPUM_3652 ydgF -243 51.9 AGGAGCAGCTTCTGGAGAGACCGCATATGTGTGCGGCGCCGAAGGGTTCACAATCTCAGGCAAAAGGACAGAAGAGTACGA
Bacillus licheniformis DSM 13
BLi02631 gcvT -250 38 TTGACGCAACTCTGGAGAGAGTTTGTATCATATTATGTTTTGCAAACCACCAAAGGGGACATCTTTGCTTTTGATGCAAAGTAAACTTTCAGGTGCCAGGACAGAGAGCCTCCA
BLi02631 gcvT -350 49.6 AATGACGGCAAGGGGAGAGACCGGCAGAGGGAAACCTAAAAGCGGCGCCGAAGGAGCAAGCTGGGGAAACAGTGAATCTCTCAGGCAAAAGAACTCTTGCT
Anoxybacillus flavithermus WK1
Aflv_0915 gcvT -229 60.5 TGAGAACAAGGGGAGAGACTACAGCATGTAGCGCCGAAGGAGCAAGTGGCAACACGAATCTCTCAGGCAAAAGAACTCTTGTTTG
Aflv_0915 gcvT -145 47.2 GACGCAGCTCTGGAGAGCGTTCACAAACGTGAACCACCCACGAGGACACCTAATTACTTAGGGAAACTTTCAGGTGAAAGGACAGAGACTACCATAT
Geobacillus kaustophilus HTA426
GK2425 gcvT -192 38.2 TTGACGCAGCTCTGGAGAGCGCCTGCGTTCACGCAGGCCACCCAAGAGGAAACCGATCGGCCCCATGGACCGCGAACGGACGCGCCAAACGGGCCGGCGGGAAACTTTCAGGTGCCAGGACAGAGCCCCCTTA
GK2425 gcvT -276 60.6 GATGACGGCAAGGGGAGAGACTACGGAATGTAGCGCCGAAGGAGCAAGCGGAAACGCGAATCTCTCAGGCAAAAAGACTCTTGCT
Bacillus cereus ATCC 14579
BC2317 glyP -228 60.1 GGGACGAATCTCTGGAGAGACTCCCTCTCGCTTTCATAGAGCGCGGAGGAAAACGAGCACCGAAGGAGCAAATCCGCTACTTTAGCGGATAATCTCTCAGGTAAAAGGACAGAGACAAGCGA
BC2317 glyP -330 36.8 GATGAACCATTCAGGAGAAGGTCTATTGATCTACCGACGGGGCAAAAAGTTGTTATACCAGCTTTGAAACTCTCAGGTCTTGGTTACAAGTAGAACTGCATGG
Bacillus halodurans C-125
BH2816 gcvT -327 43.1 TCGACGCAGCTCTGGAGAGCGTCTAACACTAGACCACCTACGAAGACATTTCCTTTTTACGATAAGGGGAAAGAAACTTTCTGGTAACCGGACAGAGCTTTACAC
BH2816 gcvT -417 62.4 GATGAAAGCAAGGGGAGAGACTGCAAGGATGCAGCGCCGAAGGAGCAAACACAATTAGGGTGTGAATCTCTCAGGCAAAAAGACTCTTGCT
Bacillus clausii KSM-K16
ABC2495 gcvT -185 35.1 TTGACGCATCTCTGGAGAGCGCTTTTTATAAGCCACCTACGAAGACAATTCGGCTTTTGGCCGAGGGAAACTTTCTGGTTCAAGGACAGGGCATACACA
ABC2495 gcvT -274 59.7 GATGATGGTAAAGGGAGAGACTGGGCATTTACGCCCAGCGCCGAAGGAGCAAGCATTTTGCGAATCTCTCAGGCAAAGAAGACTTTTACT
Oceanobacillus iheyensis HTE831
OB1904 gcvT -135 43.4 ATGACGCAACTCTGGAGAGTGTTTACGAAGGTAAACCACCCACGAAGCAAATATTTGTTCTTTTTTGAAGAATGAATATGCAACTTTCTGGTATAAGGACAGAGATTTCTTC
OB1904 gcvT -222 53.5 GAAGATTACAAGGGGAGAGTTTACAACGAATAGTAACGCCGAAGGAGCAAGTGAAGAGCGAATCTCTCAGGCCAAAAAGACTCTTGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD