Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Staphylococcaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA1367 gcvT -173 68.1 AGTGATCAGTATTAGAGAGAATAGAGCGTTAAGACTCTATCGCCGAAGGTGCAAGTAATTTATTACGAAACTCTCAGGCAAAAGGATAATACTGTAACG
Staphylococcus capitis SK14
STACA0001_1774 gcvT -213 44.5 ATTGATCAGTATTAGAGAGAATAAAGCTAAAACATATCTACATAATAATTAATTTAAGAATATTGTAAATATTTAGCTTTATCGCCGAAGGTGCAAGTTATTTAACGAAACTCTCAGGCAAAAGGATAATACTGTAACG
Staphylococcus epidermidis ATCC 12228
SE1222 gcvT -222 51.9 ATTGATCAGTATTAGAGAGAATAGAGATCAAAACTTGAATCATTATAAGTTAAACGTTTTTAGTCTATTACAATTTTGACTCTCTATCGCCGAAGGTGCAAGTGAAATAACGAAACTCTCAGGCAAAAGGATAATACTGTAACG
Staphylococcus carnosus subsp. carnosus TM300
Sca_1161 gcvT -214 55.8 AATGATCAGTATTGGAGAGCATAGGTTTTGACTATTGAAAAGCAACTTGCTTTTTAATAAATTGTCAGAATTTATCGCCGAAGGGGCAAGATAATTGTTCGAATCTCTCAGGCAAAAGGATAATACTGTGACG
Staphylococcus haemolyticus JCSC1435
SH1379 gcvT -191 53.2 TGATCAGTATTAGAGAGAATAAAAATATTGTACTTAAATTTAAGTACAATGATTTTTATCGCCGAAGGTGCAAGTTAACTACTAAACTCTCAGGCAAAAGGATAATACTGCTACGCA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1218 gcvT -186 61.6 TGATCAGTATTAGAGAGAATGGTAGTTATACTTAATATAACTTAACTTTAGTCCATCGCCGAAGGTGCAAGTTTTTACGAAACTCTCAGGCAAAAGGATAATACTGTAACGCA
Macrococcus caseolyticus JCSC5402
MCCL_1181 gcvT -119 57.9 GAAGAAGGAAATTAGAGAGAATGAGAAATCATCGCCGAAGGGGCAACGCTATATTAAACTCTCAGGCAAAAGGATAATTTCCGGACA
MCCL_1181 gcvT -119 57.9 GAAGAAGGAAATTAGAGAGAATGAGAAATCATCGCCGAAGGGGCAACGCTATATTAAACTCTCAGGCAAAAGGATAATTTCCGGACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD