Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Shewanellaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_0858 glyP -392 41.8 TGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTTGTTGGAAGCATTCCATAAACAAAGCACTCTTTCAGGTGCCGCAAGGCGTGGACTGTTACTGGACGAG
SO_0858 glyP -270 54.2 CTCTGGAGAGACTACCGATTGCATTAACTTGCAATAATAGGTGGCGCCGAAGGCGAAAGTGTCGCTGTGTTGTTAAGCGACGCGAAACGCTCAGGCAAAAGGACAGAGGAG
Shewanella putrefaciens CN-32
Sputcn32_3143 glyP -314 53.3 GCCTCTGGAGAGACTACCGCTACACTTGATAGTGTGGAAAGGTGGCGCCGAAGGCGAAAGTGTCGCCGTGTTCTTAATGAAGATGCGACGCGAAACGCTCAGGCAAAAGGACAGAGG
Sputcn32_3143 glyP -464 40.2 GATGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTCTTTTTATCCCACACTCGATTTTTAAAATCAGTTGCAGGGATGAGAAGCAAAGCACTCTTTCAGGTGCCGTAAGGCGTGGACTGCTACTGGACG
Shewanella sp W3-18-1
Sputw3181_0800 glyP -462 40.2 TGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTCTTTTTATCCCACACTCGATTTTTAAAATCAGTTGCAGGGATGAGAAGCAAAGCACTCTTTCAGGTGCCGTAAGGCGTGGACTGCTACTGGACGAG
Sputw3181_0800 glyP -312 53.3 CTCTGGAGAGACTACCGCTACACTTGATAGTGTGGAAAGGTGGCGCCGAAGGCGAAAGTGTCGCCGTGTTCTTAATGAAGATGCGACGCGAAACGCTCAGGCAAAAGGACAGAGGAG
Shewanella sp ANA-3
Shewana3_3420 glyP -271 52.9 GCCTCTGGAGAGACTACCGATTGCGTTGAGTCGCGATAATAGGTGGCGCCGAAGGCGAAAGTAGGTGCGTCGATGGATGCATTCTGCGAAACGCTCAGGCAAAAGGACAGAGG
Shewana3_3420 glyP -391 42.3 GATGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTTTGGGATCTTTCCCGAACCAAAGCACTCTTTCAGGTGCCGCAAGGCGTGGACTGTTACTGGACG
Shewanella sp MR-4
Shewmr4_0714 glyP -390 42.2 TGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTTTTGGGATCTTTCCCGATACAAAGCACTCTTTCAGGTGCCGCAAGGCGTGGACTGTTACTGGACGAG
Shewmr4_0714 glyP -269 53.2 CTCTGGAGAGACTACCGATTGCGTTAAGTCGCGATAATAGGTGGCGCCGAAGGCGAAAGTAGGTGCGTCGATGGATGCATTCTGCGAAACGCTCAGGCAAAAGGACAGAGGAG
Shewanella sp MR-7
Shewmr7_3308 glyP -270 53.6 GCCTCTGGAGAGACTACCGATTGCATTAGGTTGCAATATTGGTGGCGCCGAAGGCGAAAGTAGGTGCGTCGATGGACGCATTCTGCGAAACGCTCAGGCAAAAGGACAGAGG
Shewmr7_3308 glyP -391 42.2 GATGAAGGTAGCAGGAGAGTGGGGAATTAACCCCACACCGACGAGGCAACTTTGTTTTGGGATCTTTCCCGATACAAAGCACTCTTTCAGGTGCCGCAAGGCGTGGACTGTTACTGGACG
Shewanella baltica OS155
Sbal_3506 glyP -374 50 GCCTCTGGAGAGACTGCCAATTGCACTTAATTTAAAGTGTGATCAGGTGGCGCCGAAGGCGAAAGTGTCGTGGTGTTATTGAACCGCGACGCGAAACGCTCAGGCAAAAGGACAGAGG
Sbal_3506 glyP -523 36.5 GATGAAGGTAGCAGGAGAGTGGGGAATTGACCCCACACCGACGAGGCAACTTTGGTTTTATTTGAAGCGACGGTTATATTGAATCGAATCTTCCCATAAAAACAAAGCACTCTTTCAGGTGCCGATAGGCGTGGACTGTTACTGGACG
Shewanella amazonensis SB2B
Sama_2953 glyP -240 52.5 GCCTCTGGAGAGATCCGGTCAGTTACGTTTGGCATCACAGATGCCTGCGGTAATCGGCACCGGGCGCCGAAGGCGAAAGCCCCTTTGGGGTGAAACGCTCAGGCAAAAGGACAGAGG
Sama_2953 glyP -357 36.6 GATGAAGGTAGCAGGAGAGTTGGGGCGTGCCCCACACCGACGAGGCCAACTTCGATGCAAGTCGAAGGACTCTTTCAGGTGCCAGGAATTGACCTGGTGTGGACTGCTACTGGACG
Shewanella loihica PV-4
Shew_0496 glyP -355 45.1 CCTCTGGAGAGACTGAGAGCCCAGGATAACCCCTAGGTATCACGGCGCCGAAGGCGAAAGTGCAGCCCCAATGGCTGCGCGAAACGCTCAGGCAAAAGGACAGAG
Shew_0496 glyP -480 41.3 GATGAAGGTAGCAGGAGAGTGGGGAGTCAACCCCACACCGACGAGGCAAGTTTGTCGCCAGGCGTTATCGGCGAGAAACCACTCTTTCAGGTGCCATATTGTGGCGTGGACTGTTACTGGACG
Shewanella pealeana ATCC 700345
Spea_0715 glyP -462 35.1 TGAAGGTAGCAGGAGAGTGGGGAGTAACCCCACACCGACGAGGCAACTTCGTTAGGCTTTAAGCTAAACGAAGCACTCTTTCAGGTGCCACATAGTGGTGAGGACTGTTACTGG
Spea_0715 glyP -349 58.3 GACGAGCCTCTGGAGAGACTGTGAGCAGCTAAGTGTTCGTAAGCTTAATTGTCACACAGCGCCGAAGGCGAAAGTGTAAACTCAGCTATTAAACCTAGCTATGAGGTTACGCGAAACGCTCAGGCAAAAGGACAGAGGAGAGGATGA
Shewanella halifaxensis HAW-EB4
Shal_0768 glyP -451 35.7 TGAAGGTAGCAGGAGAGTGGGGAGTAACCCCACACCGACGAGGCAACTTTGTTATTGCTAACGCGTTAACAAAGCACTCTTTCAGGTGCCACATGGTGGTGAGGACTGTTACTGG
Shal_0768 glyP -337 60.5 GACGAGCCTCTGGAGAGACTGTGAGCAGATAAGTGTTCGTAAGCTTAATTGTCACACAGCGCCGAAGGCGAAAGTGCAAACTCTATCATTGAGTTTACGCGAAACGCTCAGGCAAAAGGACAGAGGAGAGGATGA
Shewanella piezotolerans WP3
swp_4361 glyP -337 59.8 TGGACGAGCCTCTGGAGAGACTGTGAGCAAATAAGTGTTCGTCAGCTTGATTGTCACGCAGCGCCGAAGGCGAAAGTGTTAGCATTTTTTGCTAATGCGAAACGCTCAGGCAAAAGGACAGAGGAGAGGAT
Shewanella sediminis HAW-EB3
Ssed_3886 glyP -324 52.2 TGGACGAGCCTCTGGAGAGATCGTAAACAGGTATTCAAATCTGAATAACTGTATTGCGGCGCCGAAGGCGAAAGTGTCACAGTGAATTCGTTCACTGACCAATAGCCAAACTTATCGTTTGGGTATAGACGCGAAACGCTCAGGCAAAAGGACAGAGGAGAGGAT
Ssed_3886 glyP -476 23.1 GATGAAGGTAGCAGGAGAGTGGGGAATTGCCCCCACACCGACGAGGCAACTTTGGTTTAGCGTTTTAATTTAGTACTTTTTATTGAGTACTTTTATTTAGCTCAGACCAAATACTCTTTCAGGTGCCAATTGTGATTGGCGT
Shewanella woodyi ATCC 51908
Swoo_3785 glyP -320 53.2 GCCTCTGGAGAGACTGTGAGCAGCTAAGTGTTCGTCAACTTAACTGTCACACAGCGCCGAAGGCGAAAGTGTTAGCCCAAATGGCAAACGCGAAACGCTCAGGCAAAAGGACAGAGG
Swoo_3785 glyP -444 35.8 GATGAAGGTAGCAGGAGAGTGGGGAATTGCCCCCACACCGACGAGGCAACTTTAGATCTGTTTGATTTGGTCTAAATACTCTTTCAGGTGCCAATTGTGATTGGCGTGGACTGTTACTGGACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD