Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE2 in Rhodospirillales

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE2 - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azospirillum sp. B510
AZL_015260 modA -21 5.4 GCTGTATCCGTTTGAATATATA
Rhodospirillum centenum SW
RC1_2219 modA -41 5.5 GATGTATTCTCATGGATACATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD