Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE in Comamonadaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2028 modA -13 7.3 CGCTATTCAGTCGATGAATAGCG
Acidovorax sp. JS42
Ajs_3123 modE -13 7.3 CGCTATTCCATTGATGAATAGCG
Ajs_3124 modA -34 7 CGCTATTCATCAATGGAATAGCG
Comamonas testosteroni KF-1
CtesDRAFT_2992 modA -13 7.3 CGCTATTCAAACAATGAATAGCG
CtesDRAFT_2991 modE -89 7.1 CGCTATTCATTGTTTGAATAGCG
Delftia acidovorans SPH-1
Daci_1521 modE -86 7 CGCTATTCCGTTGGTGAATAGCG
Daci_1520 modA 26 6.8 CGCTATTCACCAACGGAATAGCG
Rhodoferax ferrireducens DSM 15236
Rfer_2857 modE -74 6.9 CGCTATTCTAATTAGGAATAGCG
Rfer_2858 modA -90 6.5 CGCTATTCCTAATTAGAATAGCG
Verminephrobacter eiseniae EF01-2
Veis_2888 modA -44 7.4 CGCTATTCCTTCAATGAATAGCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD