Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE in Oceanospirillales/Alteromonadales

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_02455 modE -80 6.2 AGCGTTATATAGAATACTATATAGCGCT
Marinomonas sp. MWYL1
Mmwyl1_0979 modA -73 6.6 TTCGTTATATAGTTCAATATATAACGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD