Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE in Vibrionales

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio angustum S14
VAS14_11339 modA -43 7.6 CGATATGTAGTTTACTATATATCG
Photobacterium profundum SS9
PBPRB1349 modA -50 7.3 CGATATGTAGTAAGGTATATATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD