Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Comamonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_4196 rbsB -124 6.8 AAGCGCAAACGTTTGCGCAA
Variovorax paradoxus S110
Vapar_4636 rbsB -95 6.6 ATTAGCAAACGTTTGCGCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD