Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL1834 rbsB -75 6.3 CTGCGCAAACGTTTGCTCGT
Burkholderia sp. 383
Bcep18194_A4745 rbsB -78 6.5 TGGCGCAAACGTTTGCTCAC
Burkholderia cepacia AMMD
Bamb_1503 rbsB -77 6.7 GGGCGCAAACGTTTGCTCGC
Burkholderia vietnamiensis G4
Bcep1808_1558 rbsB -80 6.1 TAGCGCAAACGTTTGCTTGC
Burkholderia glumae BGR1
bglu_1g18680 rbsB -70 6.6 TCGAGCAAACGTTTGCTCAA
Burkholderia xenovorans LB400
Bxe_A1997 rbsB -84 6.5 CCTCGCAAACGTTTGCGCGC
Burkholderia phymatum STM815
Bphy_1237 rbsB -65 6.6 GCTCGCAAACGTTTGCGCAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD