Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Pseudomonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA1946 rbsB -76 6.5 TAACGCAAACGTTTGCGTCT
Pseudomonas entomophila L48
PSEEN1952 rbsB -52 6.6 CACCGCAAACGTTTGCGATC
Pseudomonas putida KT2440
PP2454 rbsB -53 6.4 CAACGCAAACGTTTGCTATC
Pseudomonas syringae pv. tomato str. DC3000
PSPTO2367 rbsB -84 6.6 CCTCGCAAACGTTTGCGTGT
Pseudomonas fluorescens Pf-5
PFL_2101 rbsB -140 6.3 TTACGCAAACGTTTGCGCGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD