Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Pasteurellales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0501 rbsD -37 6 TTATCGAAACGTTTCGATAA
Pasteurella multocida subsp. multocida str. Pm70
PM0156 rbsD -46 6.1 TCATCGAAACGTTTCGATGA
Actinobacillus succinogenes 130Z
Asuc_0194 rbsD -51 6.1 TCATCGAAACGTTTCGATAA
Haemophilus somnus 2336
HSM_0089 rbsD -72 5.9 TAATCGAAACGTTTCGATGA
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_1729 rbsD -48 6.1 TCATCGAAACGTTTCGATAA
Haemophilus parasuis SH0165
HAPS_1629 rbsD -40 6.3 TCATCGAAACGTTTCGATGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD