Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VCA0127 rbsD -86 7 TCATCGAAACGTTTCGATGT
Vibrio vulnificus CMCP6
VV20061 rbsD -72 7.2 TCATCGAAACGTTTCGATGA
Vibrio harveyi ATCC BAA-1116
VIBHAR_06146 rbsD -222 6.2 CTATCGAAACGTTTCGATTT
VIBHAR_06146 rbsD -95 7 TCATCGAAACGTTTCGATGT
Vibrio parahaemolyticus RIMD 2210633
VPA1087 rbsD -226 7 CCATCGAAACGTTTCGATGA
VPA1087 rbsD -96 6.7 GCATCGAAACGTTTCGATGA
Vibrio shilonii AK1
VSAK1_16182 rbsD -170 6.6 TCATCGAAACGTTTCGATAG
VSAK1_16182 rbsD -87 7.2 TCATCGAAACGTTTCGATGA
Vibrio splendidus LGP32
VS_II0940 rbsD -26 6.6 CTATCGAAACGTTTCGATGG
VS_II0940 rbsD -104 7 CCATCGAAACGTTTCGATGA
Vibrio fischeri ES114
VF_1444 rbsD -71 6.4 TTACGCAAACGTTTCGATGA
Vibrio salmonicida LFI1238
VSAL_I1372 rbsD -70 6.4 TTACGCAAACGTTTCGATGA
Vibrio angustum S14
VAS14_09005 rbsD -226 6.8 TTATCGAAACGTTTCGATGG
VAS14_09005 rbsD -96 6.6 CTATCGAAACGTTTCGATGG
Photobacterium profundum SS9
PBPRB1556 rbsD -118 5.7 CCATCGAAACGTTTGCGTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD