Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Oceanospirillales/Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate; Fructose-1,6-diphosphate
Regulog: FruR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromohalobacter salexigens DSM 3043
Csal_2648 fruB -118 5.6 TAGCTGACACGATTCAGCCC
Csal_0932 pgi -69 5.8 AAGCTGACACGATTCATCCA
Csal_0500 COG2814 -67 4.8 ACGCTGATTCGATTCAGCAC
Csal_2649 fruR -161 5.6 GGGCTGAATCGTGTCAGCTA
Csal_0372 gap -15 5 GAGCTGAATCGTGTCATGCC
Reinekea sp. MED297
MED297_11620 fruR -63 4.5 AAGCTGAATGCATTCAGCAA
MED297_11615 fruB -41 4.4 CTGCTGAACCGTTTCAGTAT
MED297_11620 fruR -197 4.4 ATACTGAAACGGTTCAGCAG
MED297_11615 fruB -175 4.5 TTGCTGAATGCATTCAGCTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD