Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KdgR in Pasteurellales

Properties
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Regulog: KdgR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mannheimia succiniciproducens MBEL55E
MS0698 oglP -155 6.1 AATTAAAATAATGTTTTATTT
MS0561 oglO -208 5.1 ATTAAAAATAAAATTTTAGAA
MS0562 kdgR -126 5.9 ATATAAAACATAATTTCATTT
MS1742 pelX -124 4.8 TAATAAAATAAAACATTATTT
MS1741 togX -99 6.1 AAATAAAACAATGTTTTAAAT
MS1742 pelX -119 6.1 AAATAAAACATTATTTCAAAT
MS0561 oglO -170 5.9 TTTTAAAATATTGTTTTATTT
MS0561 oglO -107 5.3 ATTTGACATAGTGTTTCAATT
MS0563 kduD -88 5.9 AAATGAAATTATGTTTTATAT
Actinobacillus succinogenes 130Z
Asuc_1469 pelX -73 5.2 AAATAAAATTGTGTTATATTA
Asuc_1923 oglP -153 5.5 ATTCAAAACATAATTTCATTT
Asuc_1468 togX -97 5.8 AAATAAAATTTTGTTTCAAAA
Asuc_1468 togX -102 5 ATTAAAAATAAAATTTTGTTT
Asuc_1469 pelX -117 5.8 TATTAAAATAATGTTTCAAAA
Asuc_1477 oglO -148 5.4 TTTTAAAACCATATTTCAATT
Asuc_1475 kdgR -126 5.4 TTCTGAAATACAATTTCAATT
Asuc_1474 kduD -122 5.4 AATTGAAATTGTATTTCAGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD