Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KdgR in Vibrionales

Properties
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Regulog: KdgR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio vulnificus CMCP6
VV20914 kduD -189 5.2 TTTTAAAATACCTTTTCATAA
VV20914 kduD -115 6 TTTTGAAACGTCTTTTCAAAA
VV20905 kdgK -81 5.7 AATTGAACCATTGTTTTAAAA
VV20915 kdgR -234 4.9 AAGTGAACCGACGTTTTGGTT
VV20915 kdgR -158 5.8 TTTTGAAAAGACGTTTCAAAA
VV20915 kdgR -84 5.4 TTATGAAAAGGTATTTTAAAA
VV21107 null -114 5.8 TATTGAAATGATGTTTCAAAA
VV21107 null -67 5.5 AAATAAAAAGATGTTTTAAAA
VV21108 null -115 5.3 TTTTAAAACATCTTTTTATTT
VV21108 null -68 5.6 TTTTGAAACATCATTTCAATA
VV21092 ugl -127 5.5 AATTGAAAAGGTGTTTTGAAA
VV21106 null -162 5.5 TATTGAAACGCTTTTTTATAT
VV21106 null -56 5.2 AATTGAACCATCATTTCATTT
Vibrio parahaemolyticus RIMD 2210633
VPA0077 kduD -194 5.6 TTTTAAAATGCCTTTTCAAAA
VPA0077 kduD -121 5.8 TTTTAAAACGCCTTTTCAAAA
VPA0084 togX2 -130 5.2 TTTTGAAACACCATTTTATTT
VPA0085 kdgM -110 5.4 AATTAAAACACCGTTTTAAAG
VPA0085 kdgM -20 5.5 AAATAAAATGGTGTTTCAAAA
VPA0084 togX2 -40 5.2 CTTTAAAACGGTGTTTTAATT
VPA0082 kdgK -82 5.4 AAATGAACCGTTGTTTTATTT
VPA0087 togX1 -93 5.5 AAATGAACCGTTGTTTTGATT
VPA0087 togX1 -29 5.1 AATTAAAACAGCGTTTCGAGG
VPA0076 kdgR -140 5.8 TTTTGAAAAGGCGTTTTAAAA
VPA0076 kdgR -67 5.5 TTTTGAAAAGGCATTTTAAAA
Vibrio shilonii AK1
VSAK1_20309 kduD -195 4.8 TTTCAAAAAGGCTTTTCATAA
VSAK1_20309 kduD -119 5.6 AAATGAAACGGCATTTCAAAA
VSAK1_20364 VSAK1_20364 -189 5.8 TATTAAAACGCCGTTTTAATA
VSAK1_02644 kduI -164 5.5 TTTTAAAACGCAGTTTCAAAA
VSAK1_20304 kdgR -161 5.4 TTTTGAAATGCCGTTTCATTT
VSAK1_20304 kdgR -85 5.4 TTATGAAAAGCCTTTTTGAAA
Photobacterium profundum SS9
PBPRB1737 kduD -194 5.6 TTTTAAAAAGCCTTTTCAAAA
PBPRB1737 kduD -121 5.8 TTTTAAAACGTTATTTCAAAA
PBPRB1726 kdgM -122 5.6 AATTAAAACGCCGTTTCAATG
PBPRB1726 kdgM -32 5.8 AATTAAAACGGCGTTTTAAAA
PBPRB1723 togX1 -149 5.5 AAATGAACCGTTGTTTCGATT
PBPRB1723 togX1 -85 5.3 AATTAAAACGGCGTTTCGAGG
PBPRB1731 kduI -124 5.4 TTTTGAAACGATGTATCAATA
PBPRB1738 kdgR -158 5.7 TTTTGAAATAACGTTTTAAAA
PBPRB1738 kdgR -85 5.6 TTTTGAAAAGGCTTTTTAAAA
PBPRB1733 kdgK -81 5.4 TTATGAACCGATGTTTTATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD