Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Fur in Xanthomonadales

Properties
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xylella fastidiosa 9a5c
XF0175 COG1272 -37 5.1 AAATGCGAATTATTCGCGGTT
XF0932 feoA -34 4.7 TATTGAGAACGATTCTTGTCA
XF0394 bfd -64 5.4 AATTGACATTCATTCTCATCT
XF0395 bfr -78 4.9 TAATGAGCACGATTTTCGTTC
XF0599 fhuA -112 5.6 TATTGAAAATCATTCTCCTTT
Xanthomonas axonopodis pv. citri str. 306
XAC3043 COG1272 -37 4.3 CGATGCGAATCGCTCGCAATT
XAC3620 pfeA -177 4.9 ATTTGAGAATGAATCGCATCT
XAC1458 fpr -71 5.5 AAATGAGAGTTCATCTCATTT
XAC3370 fhuE -120 6 AAATGTGAATCATTCCCATTA
XAC0176 fpvA -175 5.6 AAACGATAACGATTTACATTT
XAC1854 feoA -35 4.6 AATTGAGAACCATTCCTAACA
XAC0493 bfr -80 4.4 AACTGATCACGATTCGCGTTC
XAC0492 bfd -73 5 AATTGACACCTATTCTCGTTT
XAC0822 hemP -2 6.1 AAATGAGAATGGTTATTATTT
XAC0822 hemP -26 4.9 AAATGAGAATGGCTCTTGATC
XAC1435 fhuA -28 5.2 ATTTGATAACCATTCCCATTA
XAC2941 fhuA -252 5.5 AAAGAAGAATGATTTGCATTT
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC1414 fpr -73 5.5 AAATGAGAGTTCATCTCATTT
XCC4162 COG4773 -31 4.6 GGATAAGAATCGTTATCATTG
XCC3518 fpvA -72 5.2 TAATAATATTCATTCTCACTT
XCC3216 fhuE -121 6 AAATGTGAATCATTCCCATTA
XCC0158 fpvA -167 5.6 AAACGATAACGATTTACATTT
XCC1834 feoA -35 4.6 AATTGAGAACCATTCCTAACA
XCC0481 bfd -73 5 AATTGACACCTATTCTCGTTT
XCC0482 bfr -80 4.4 AACTGATCACGATTCGCGTTC
XCC0767 hemP -2 6.1 AAATGAGAATGGTTATTATTT
XCC1391 fhuA -28 5.2 ATTTGATAACCATTCCCATTA
XCC0767 hemP -26 4.9 AAATGAGAATGGCTCTTGATC
XCC2772 fhuA -263 5.5 AAAGAAGAATGATTTGCATTT
Stenotrophomonas maltophilia K279a
Smlt2935 fecI4 -87 4.6 GGATGCAAATGATTCTCTTTT
Smlt3227 fpr -61 5.5 CAATGAGAACCCATCTCATTT
Smlt3999 fhuE -94 4.8 AAATAGGAATAGTTCGTATTA
Smlt1145 null -99 5.3 TTTTGGCAATCATTCTCATTT
Smlt2848 fecI -28 5.8 TAATGGGAATCATTCGCATTA
Smlt1145 null -76 4.1 AACGGCTAACAGCTCTCATTA
Smlt3900 fecI3 -69 5.1 GAACGTGACTGATTCTCATTA
Smlt2858 COG4771 4 5 AATCAGCAATAATTCTCATTT
Smlt1567 XAC0271 -126 5.6 AAATGCGAATGCCTATCATTT
Smlt2664 fecI2 -86 5.4 AAACGCGAACGGTTCCCATTA
Smlt2210 feoA -38 4.5 AATCGAGAACCATTTACATCC
Smlt1233 fpvA -136 4.5 TGTTAAGAATTATTTACATTT
Smlt1426 pfeA -142 4.8 ATTTGAGAATCACTCGCATTG
Smlt3022 fhuA -42 5.9 AAATGCTAATCTTTCTCATTT
Smlt0794 hemP -45 6.1 AACTGAGAATCATTATCATTT
Smlt0794 hemP -69 5.1 AATTGAGAATGGTTGTTGATT
Smlt4297 bfr -81 4.2 CAATGCGCACGATTCGCGTTC
Smlt4298 bfd -73 5.4 GATTGACAACCATTCTCGTTT
Smlt1142 pepSY -85 4.6 AATTGCGAGCTATTCTCATCA
Smlt1149 null -66 5.1 ATATGCGAATCATTATCGTTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD