Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Fur in Psychromonadaceae/Aeromonadales

Properties
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_3007 fbpA -32 4.5 TATCGTGAATTATTACCATTT
Ping_3007 fbpA -56 5.2 TAATGATTATCATTATTATTA
Ping_3007 fbpA -62 5.9 AAATGGTAATGATTATCATTA
Ping_0309 COG3205 -57 6.2 AAATGATAACAGTTATCATTT
Ping_0688 irpA -56 4.9 TAATGATAATCAATACTATTC
Ping_0688 irpA -62 4.7 TTTTGATAATGATAATCAATA
Psychromonas sp. CNPT3
PCNPT3_08705 fecF -85 5.1 TAGTGATTATTGTTATCATTT
PCNPT3_08705 fecF -91 4.9 AAATGATAGTGATTATTGTTA
PCNPT3_11948 fbpA -32 5.2 AATTGATAATCATTATTACCA
PCNPT3_11763 null -111 5.4 GAATGAGAACTATTCTCGTTT
PCNPT3_11763 null -156 5 TATTGATAATGACTTTCATTG
PCNPT3_07645 sitA -74 5.1 TAATGATTATCGTTTGCATTT
PCNPT3_07645 sitA -80 5.2 TCATGATAATGATTATCGTTT
PCNPT3_09369 null -59 5.6 GAATAATAATGATTATCATTA
PCNPT3_00271 ftr1 -58 5.7 TAATGGTAATTATTATCAATT
PCNPT3_10053 PCNPT3_10053 -57 5.7 AATTGCAAATAATTCTCATTA
PCNPT3_00166 PCNPT3_00166 -162 5.4 TGGTGATAATGGTTATCATTA
Moritella sp. PE36
PE36_07672 fbpA -102 6 TTATGAGAATTATTATCATTT
PE36_02327 PE36_02327 -94 6.2 TAATGAAAATTGTTATCATTT
PE36_14229 null -58 5.3 TAATGATAACCATTCTTAATC
PE36_14199 null -58 5.4 TAATACGAACCATTCTCATTA
PE36_17360 sitA -85 6.3 TAATGATAATAATTCTCATTT
PE36_06587 hutB -150 5.2 TAATGCAACCAATTCTCATTT
PE36_06592 hutX -86 5.2 AAATGAGAATTGGTTGCATTA
PE36_19080 fhuB -2 4.8 TAATGAAAATTAAATTGATTT
PE36_19080 fhuB -103 4.9 AAATGAGAATGATTAATGTTA
PE36_17585 PE36_17585 -35 5.5 TAATACGAACAATTATCATTT
PE36_21674 null -71 5.6 TAGTGACAATGATTCTCATTT
PE36_01637 null -108 4.8 TAATGAAAATGGTAATGATTA
PE36_10008 null -197 4.5 TAAAGATTATCTTTTTCATTT
PE36_11667 null -53 5.8 AATTGATAATAAATCTCATTA
PE36_11667 null -70 4.8 TAATGATTTTTATTTGCAATT
PE36_01637 null -102 5.8 AAATGGTAATGATTATCAATT
PE36_11667 null -76 4.9 CTGTGATAATGATTTTTATTT
PE36_21074 PCNPT3_10053 -42 4.6 TATTGGTTATCATTCTCATCA
PE36_10008 null -85 5.7 AATTGCGAATAGTTTTCATTT
PE36_01255 irpA -57 4.8 CAATGCAAATAACTATCATTA
PE36_01255 irpA -80 5.7 TAATGATAATAATTATTATTC
PE36_09918 PE36_09918 -79 5.7 AAATGAGAATTATTCTTATAA
PE36_21679 null -55 5.6 AAATGAGAATCATTGTCACTA
PE36_09923 null -46 5.6 GAACGATAATAATTATCATTT
PE36_17310 null -75 5.5 GAATGATAGTAATTCTCATTT
PE36_08636 null -139 5.4 TTATGATAATAATTTTTATCT
PE36_07037 PCNPT3_00166 -106 4.9 TAAATACAATGATTCTCATTT
PE36_19050 null -88 5.3 TAATGGTAATAATTATCAGTA
PE36_21054 null -81 5.3 AAATAAGAACGATTCCTATTT
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_4252 PE36_02307 -59 5.4 CAATGAGAATAGTTATCATTG
AHA_2544 null -80 5.5 AATTGATAACTCTTTTCATTA
AHA_2481 null -71 5.1 TAATGCACACCATTCTCATTT
AHA_3578 COG3205 -70 6.1 AGATGAGAATAGTTTTCATTT
AHA_0966 hutB -92 5 AATTGATAATCGCTTTCATTC
AHA_0967 hutX -97 5 GAATGAAAGCGATTATCAATT
AHA_4275 null -134 5.3 AGATGCAAATGATTAGCAATT
AHA_2479 null -44 6 AACTGATAATCATTATCATTT
AHA_0709 mntH -46 6.3 AATTGATAATAATTATCATTT
AHA_2992 null -60 6.3 AATTGATAATAATTTTCATTT
AHA_0514 null -90 6.2 AAATAATAATTATTATCATTT
AHA_0461 null -112 5.8 TAATGAAAATCAATATCATTA
AHA_1970 AHA_1970 109 5.7 AAATAAAAATGATTACCATTT
AHA_1663 hutR -88 5.9 AAATGATAATGATTATCAATC
AHA_1663 hutR -20 5.8 AAATAATAATTATTCTCAATA
AHA_0972 hutR -90 4.7 AAATGAGAATGATTCCGTTTA
AHA_0972 hutR -31 4.8 GTTTGATAACAGTTCTCAATA
AHA_1965 null -84 5.8 AAATGATAAGAATTGTCATTT
AHA_1964 null -93 5.8 AAATGACAATTCTTATCATTT
AHA_1982 null -42 5.3 TATTGATAGTGGTTATCATTT
AHA_2744 feoA -38 5 AAAAGAGAATTATTATTGTTT
AHA_1987 tonB1 -123 4.6 GATTGATAATGGTTGTTGTTT
AHA_3963 null -189 6 TAATGAGATTAATTATCATTT
AHA_1953 null -43 4.9 AAATGAGATTTGTTACTATTC
AHA_0469 hemC -105 4.8 TAATAAAAATCATTTTCAGCG
AHA_0971 Ping_1736 -178 4.8 TATTGAGAACTGTTATCAAAC
AHA_0971 Ping_1736 -119 4.7 TAAACGGAATCATTCTCATTT
Aeromonas salmonicida subsp. salmonicida A449
ASA_4323 PE36_02307 -35 5.4 CAATGAGAATAGTTATCATTG
ASA_1836 null -71 5.1 TAATGCACACCATTCTCATTT
ASA_2551 null -80 5.5 AATTGATAACTCTTTTCATTA
ASA_3536 COG3205 -70 6.1 AGATGAGAATAGTTTTCATTT
ASA_3334 hutB -92 5 AATTGATAATCGCTTTCATTC
ASA_3333 hutX -97 5 GAATGAAAGCGATTATCAATT
ASA_4363 fhuA -155 5.3 AGATGCAAATGATTAGCAATT
ASA_1838 entC -119 6.3 AATTGATAATCATTATCATTT
ASA_0706 mntH -61 6.1 AATTGATAACAATTATCATTT
ASA_3720 null -35 6.2 AAATAATAATTATTATCATTT
ASA_3006 null -60 6.1 AATTGATAATAGTTTTCATTT
ASA_2695 hutR -47 5.1 AAATAACAATCATTCTCAAAA
ASA_1851 AHA_1970 -80 5.7 AAATAAAAATGATTACCATTT
ASA_3328 hutR -90 5.2 AAATGAGAATGATTCCCTTTA
ASA_3328 hutR -31 4.8 GTTTGATAACAGTTCTCAATA
ASA_2695 hutR -115 5.9 AAATGATAATGATTATCAATC
ASA_1845 null -93 5.7 AAATGACAATTTTTATCATTT
ASA_3883 null -110 5.8 TAATGAAAATCAATATCATTA
ASA_1846 entD -86 5.7 AAATGATAAAAATTGTCATTT
ASA_1862 hugW -51 5.5 AATTGATAGTGGTTATCATTT
ASA_1629 feoA -38 4.6 AAAAGCGAATTATTATTGTTT
ASA_1867 tonB1 -33 4.9 GATTGATAATAGTTATTGTTT
ASA_4368 fstB -94 5.8 AAATGATATTCATTTTTATTT
ASA_4368 fstB -100 4.9 AGATACAAATGATATTCATTT
ASA_2341 null -47 5.4 AAATGAGATTTGTTACCATTA
ASA_3875 hemC -105 5.4 TAATGAAAATCATTTTCAGCA
ASA_3329 Ping_1736 -177 4.8 TATTGAGAACTGTTATCAAAC
ASA_3329 Ping_1736 -118 5.2 TAAAGGGAATCATTCTCATTT
Tolumonas auensis DSM 9187
Tola_2559 fbpA -37 5.8 TTATGATAATGATTCTCATTA
Tola_2559 fbpA -60 5.5 AAATGATATCCGTTCTCATAT
Tola_2559 fbpA -87 5.6 AAACGATATTTATTTTCATTT
Tola_1485 fhuC -60 5.9 AATTGATAACAATTATCATCT
Tola_1489 fhuB -38 5.1 TAATGGGAATAGTTATCAGTA
Tola_0678 null -54 5.8 TATTGAGAATAATTATCAATA
Tola_2146 feoA -35 5.5 TATTAATAATGATTCTCAATA
Tola_1802 tonB1 -79 5.9 AAATAATAATGGTTCTCATTA
Tola_1488 null -68 5.4 TAATGCGAATGGTTATCAATA
Tola_2912 null -95 5.3 AGATGAAAAGGGTTATCAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD