Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Fur in Alteromonadales

Properties
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_1596 fbpA -32 6.1 AATTGATAATTATTCTCAATT
Patl_0493 yfeK -260 4.6 TAATAATAACAATACTCACCT
Patl_2402 Patl_2402 -27 6 AAATGATAATAATTAGCATTA
Patl_3803 COG4774 -59 5.3 AAATGATATTAATTACCATTC
Patl_3109 fecA -105 5.4 TATTGATAATAGTTTGCATTA
Patl_2076 bfr2 -147 4.5 AATCATCAATTATTCTCATTT
Patl_1397 bfd -46 5.4 AAACAACAATTATTATCATTT
Patl_0311 fhuE -97 5.2 GAATGCAAATAGTTATCATAT
Patl_3414 piu -51 5.6 TAATGAGAATGCTTCTTATTT
Patl_2259 Patl_0871 -83 5.8 AAATAGTAATAATTCTCATTT
Patl_1443 null -93 4.7 AAATTCAAATGATATTCATTA
Patl_1443 null -87 6 AAATGATATTCATTATCATTA
Patl_1058 ftr1 -41 6.2 AAATAATAATTATTCTCATTT
Patl_0749 COG3205 -139 5.3 AAATGAGAATTAATCGTATTA
Patl_1142 Patl_1142 -72 6.1 AATTGAAAATCATTCTCATTA
Patl_2287 fpr -70 5 AAATAAGAATTATTACTATTG
Patl_1486 COG4771 -66 5.6 AAATGATAACGATTACTATTT
Patl_1398 ahpCB -241 5.4 AAATGATAATAATTGTTGTTT
Alteromonas macleodii 'Deep ecotype'
MADE_00161 null 5 5.7 TAATGATAATAAGTATCATTT
MADE_02744 bfd -57 5.1 GAATAGCAATTATTATCATTT
MADE_00133 fhuE -102 5.5 AAATAGCAATAATTATCATTT
MADE_03816 Patl_0871 -53 5.1 TAATGAGAATCATTAACAAAT
MADE_02492 Patl_1817 -72 4.8 AAGTATAAATTATTTTTATTT
MADE_02392 COG3205 -65 6.1 AATTGATAATAATTCTCATTA
MADE_01602 null -8 6 AAATGCTAATGGTTATCATTT
MADE_01534 COG4771 -33 4.8 AAATCATTATCATTTGCATTA
MADE_01534 COG4771 -39 5.6 AAACGCAAATCATTATCATTT
MADE_02743 ahpCB -251 5.1 AAATGATAATAATTGCTATTC
MADE_02662 null -117 5.5 AAATAACAACTATTATTATTT
Glaciecola sp. HTCC2999
GHTCC_010100005814 fbpA -61 5.8 TATTGAGAATTATTCTCAATA
GHTCC_010100005799 fecA -85 5.9 AATTGAGATTGATTCTCATTT
GHTCC_010100007522 bfd -46 5.9 AAATGAGAACTATTATTATTA
GHTCC_010100007527 ahpCB -171 5.9 TAATAATAATAGTTCTCATTT
Colwellia psychrerythraea 34H
CPS_1012 fbpA -86 4.6 TAATGAGAGTGATTCGTATAT
CPS_4213 Patl_2402 -66 5.9 AAATAATAACAATTATCATTA
CPS_0262 ATW7_00890 -148 6 AAATGATAATGGTTTTTATTT
CPS_1347 COG4774 -62 6 TATTGATAATCATTATCATTA
CPS_1347 COG4774 -296 4.7 AAATGAAAAATATTATAAAAA
CPS_1169 bfd -76 5.8 TATTGATAATTGTTATCATTA
CPS_1167 bfr1 -155 4.6 TAATGAAAATACAAATTATTT
CPS_1167 bfr1 -149 5.4 AAATACAAATTATTTTCACTT
CPS_1855 CPS_1855 -155 5.1 AAATGTAAATTGTTATCAATC
CPS_2724 fhuE -85 5.1 TAACGATAATGATTAGTATTT
CPS_2724 fhuE -79 4.9 TAATGATTAGTATTTGCATTT
CPS_1858 hugA -43 5.4 AGATCATAATGATTCTTATTT
CPS_3425 null -104 5.9 AAATGATAATGATTACCATTA
Alteromonadales bacterium TW-7
ATW7_12358 fbpA -31 5.4 TATTGATAATAATTACTATTT
ATW7_13138 null -48 5 ATATGATAATGTCTATCATTT
ATW7_00890 ATW7_00890 -87 5.2 AAATGAGAATCACTATCTTTT
ATW7_00380 COG4774 -20 5.4 AAATGCGAATGGTTATCATAA
ATW7_00380 COG4774 -59 4.6 TTTTGCAAATAATAATCATTA
ATW7_00380 COG4774 -53 5.6 AAATAATAATCATTACCATTA
ATW7_15529 CPS_4959 -67 5.7 AAATGATATTTATTTTTATTA
ATW7_03447 fecA -74 4.9 TAATAATATTGATTCGCATTC
ATW7_15879 CPS_1855 -48 5.3 TAATGCAAATCATTATCATGT
ATW7_15829 pepSY -51 5.4 AAATAACAATTGATATCATTT
ATW7_04502 null -67 5.3 AAATGATAATTGTTGCTATTT
ATW7_05436 null -89 4.8 AAATAATAACAACTATTAATA
ATW7_09161 Patl_1142 -54 5.5 TAATGATAGTCGTTATCATTT
ATW7_16530 null -116 6 TAATGATAACTATTATCATTA
ATW7_13233 PF11449 -68 6.2 AAATGATATTGATTATCATTT
ATW7_02487 bfd -66 5.2 TATTGATAACTATTACTATTT
ATW7_11686 CPS_4762 -257 5 TAATGACAATAGCTATCATCT
ATW7_00730 ATW7_00730 -61 5.1 AAATAGAAATCATTACCATTA
Pseudoalteromonas haloplanktis TAC125
PSHAa2663 fbpA -32 5.3 TATTGATAATAGTTATTATTC
PSHAa1611 null -45 5.1 ATATGATAATACCTATCATTT
PSHAb0286 Patl_2402 -49 5.2 TATTGTTAATAGTTATCATTA
PSHAb0287 pepSY -149 5.1 AATTGAAAACTGCTCTCATTA
PSHAb0512 COG4774 -22 4.8 AAATACGAATACTTACCATTA
PSHAa2478 fecA -78 4.7 GAATAACATTGATTCTCATTC
PSHAa0108 CPS_4959 -62 5.5 AAATGATACTGGTTTTCATTA
PSHAb0251 irgA -47 5.9 AAATGCTAATCATTATCAATT
PSHAa2970 CPS_1855 -49 5 TAATACAAATCATTATCATGT
PSHAa0695 fhuE -65 5.6 AATTGCAAATCAATATCATTT
PSHAa2961 pepSY -52 5.1 AATTGATAATTGTTATCATGC
PSHAa0951 null -34 4.8 TAATAATAATTATTAATAATA
PSHAa0951 null -37 5.6 AAATAATAATAATTATTAATA
PSHAb0279 Patl_1142 -56 4.9 AAATGAGAGTGGTTAGCATTC
PSHAa0048 fumC -147 5.6 TAATGATAACTATTATCAAAT
PSHAa1629 PF11449 -67 6.2 AAATGATATTGATTATCATTT
PSHAb0512 COG4774 -55 5.2 TAACGATAACCATTATCATTC
Pseudoalteromonas tunicata D2
PTD2_06379 null 6 5.1 AAATTAAATTTATTAGCAATT
PTD2_08484 fbpA -33 5.6 ATTTGATAATAATTCTTATTT
PTD2_01521 Patl_2402 -23 5.9 AAATAAAAACAATTATCATTA
PTD2_01631 ATW7_00890 -83 5.2 AAATGAGAATTACTATCTTTT
PTD2_20667 COG4774 -47 5.6 AACTGATAATTATTATCATTC
PTD2_20667 COG4774 -92 5 AAATAATAATTATTCGTATAA
PTD2_09069 null -29 5.9 AAATAAGATTTATTATCATTT
PTD2_15697 null -82 5.5 TAATGAGATTGATTATCATTG
PTD2_15697 null -158 4.8 AAATAAAAATAATACTTATCA
PTD2_15697 null -155 4.6 TAAAAATAATACTTATCATAT
PTD2_02826 bfr2 -157 4.9 AAATAACAATAATTGTTATTC
PTD2_16666 CPS_1855 -162 5.8 AAATAATAACCATTATCAATT
PTD2_04291 fhuE -66 6.3 AATTGATAATAATTATCATTT
PTD2_05440 null -75 4.5 AAATGAGAATATATACTATTC
PTD2_05935 null -2 5.6 AAATGATAACGATTAACATTA
PTD2_00706 null -128 5.9 AAATGATAACAATTACCATTT
PTD2_00731 null -43 6 AAATGATAATTGATATCATTT
PTD2_10208 null -94 5.9 AAATGATAATACTTCTCATTA
PTD2_08349 bfd -64 5.8 TATTGAAAATGATTGTCATTT
PTD2_10203 hmuT -76 5.9 TAATGAGAAGTATTATCATTT
PTD2_19380 PF11449 -66 6.2 AAATGATATTGATTATCATTT
PTD2_05445 ATW7_00730 -123 4.5 GAATAGTATATATTCTCATTT
PTD2_01211 null 4 5.2 AAATGATAACAGTTATCATGC
PTD2_09069 null -85 6 AAATGATATTTATTATCATTA
Idiomarina baltica OS145
OS145_11901 fbpA -83 5.5 AAATGAGAATGGCTATCATTA
OS145_08648 fecA -64 5.3 AATTGCGAATTATTCGTATTT
OS145_11871 null -136 5.2 TGTTGAAAATCGTTCGCATTA
OS145_04633 irgA -39 6 AAATAAAAACTATTCTCATTT
OS145_01627 fhuE -190 5 AAATAAGAATGATTATGTTTT
OS145_01627 fhuE -184 4.9 GAATGATTATGTTTTTCATTT
OS145_01627 fhuE -162 5.7 AGTTGATAATCATTCTTATTT
OS145_01627 fhuE -63 5.4 AAACGCGAATCGTTTTCATTT
OS145_11766 null -63 5.3 ATTTGATAATTGTTCTTATTA
OS145_07332 piuC -39 5.4 AAATGATAACTATTCGCAAAT
OS145_09243 fpr -103 5.4 ATATGCGATTTATTCTCATTT
OS145_09243 fpr -74 6 AAATGAAAAAAATTCTCATTT
OS145_06449 hmuT -81 5.4 AAACGAAAACTATTTGCATTT
OS145_03090 Patl_2402 -52 6 TAATGAGAACAATTATCATCT
OS145_03090 Patl_2402 -17 5.5 AAATGATAAGGATTCTCATGT
Idiomarina loihiensis L2TR
IL2393 fecA -88 5.5 TATTGCGAATCATTCTTATTT
IL1065 bfd -57 5.2 TATTGCAAATCGTTCGCATTT
IL2502 CPS_1855 -89 5.9 AAATGAGAATTTTTATCATTA
IL2502 CPS_1855 -60 5.5 AAATGAGAACGGTTTTTATAT
IL2490 irgA -42 6 TAATGAAAATAATTCGCATTT
IL1059 fbpA -84 5.5 AAATGAGAATGGCTATCATTA
IL2514 fhuA -66 5.4 AAACGCGAATCGTTTTCATTT
IL0798 sodA -52 4.8 AAATGCAAATGATAATGATTA
IL0798 sodA -46 5.4 AAATGATAATGATTACCGTTA
IL0069 piu -52 4.7 ACAATATAATCATTCTCATTT
IL1578 null -105 6.2 AAATGATAATGGTTTTCATTA
IL1577 Patl_1817 -59 6.2 TAATGAAAACCATTATCATTT
IL0795 null -67 6 AATTGATAATAGTTATCATTA
IL2512 null -58 5.1 ATTTGATAATTGTTCGTATTT
IL0111 ftr1 -85 5.2 AAACAACAATAGTTATCATTT
IL2512 null -85 5.4 AAATGAGAATTGTTCGCAACA
IL0759 piuC -36 5.2 AAATGATAACTATTCGCAAGT
IL2501 fpr -104 5.5 ATATAAAAACCGTTCTCATTT
IL2501 fpr -75 5.9 TAATGATAAAAATTCTCATTT
IL0113 hmuT -87 5.5 AAACGAAAATGATTTGCATTT
IL0109 null -177 5.5 TATTGATACTGATTCTCATTT
IL1581 fhuE_1 -66 5.2 AAATGATAACGATTCGTAGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD