Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Fur in Vibrionales

Properties
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC2210 viuB -140 5.5 TAATGATATACATTCTCATTT
VC0771 VC0771 -167 6.1 AAATGATAATTGTTATTATTT
VC0364 bfd -54 4.9 AAATAAGAGTGATTCTCTTTT
VC2211 viuA -290 5 AAATGAGAATGCTTTACATTT
VC2078 feoA -46 5.1 TAATAGTAATATTTCTTATTA
VCA1041 VCA1041 -61 5.2 TTTTGAGAATAAATATCAATT
VC0091 COG3315 10 4.9 ATTTGAGATTCATTATCATCT
VC0091 COG3315 -23 4.4 TGTTGAGATAAATTCTCAACA
VC1688 PF11449 1 4.9 TGTCGATAATAATTCTCATTC
VC1688 PF11449 -24 5.1 AATTGCGAATAGTTCTCAACT
VC2209 vibF -90 4.4 TGATAATGATTATTATTAACT
VC2209 vibF -93 5.9 AATTGATAATGATTATTATTA
VC0475 irgA -34 6 AATTAAGAATAATTATCATTT
VC1009 PF10952 -53 5.8 ACATGATAATAATTATCAATT
VC2694 sodA -37 6 TAATGATATTAATTATCATTA
VC0776 viuP -2 4.9 AAATGAGAATCAATATTACAA
VC0776 viuP 16 4.8 CAATGAAAAACATTTTTATTT
VCA0909 hutW -107 5.3 TAATAATAGCAATTATCAATT
VCA0576 null -60 5.7 AAATGATAGCAATTATCATTA
VC0775 vibH -214 4.8 AAATAAAAATGTTTTTCATTG
VC0775 vibH -196 4.9 TTGTAATATTGATTCTCATTT
VC0774 VC0774 -97 5.7 AAATGAGAATAGTTTTTATTA
VC0774 VC0774 -74 4.7 AAATGCAAGCAATTTCCATTT
VC0474 irgB -131 6 AAATGATAATTATTCTTAATT
VCA0068 torS -41 5.4 TAACGATAATTATTCTTAATA
VC0773 VC0773 -114 4.7 AAATGGAAATTGCTTGCATTT
VC0773 VC0773 -91 5.7 TAATAAAAACTATTCTCATTT
VC0608 fbpA 4 5.2 GATTGATAAAGGTTATCATTA
VC1264 irpA -2 5.8 AAATGATAATAATTTGCAATT
VC1548 PF11932 -58 4.8 TAATGAGAGCGTTTCTCAATA
VCA0910 tonB-hmu -170 5.3 AATTGATAATTGCTATTATTA
VCA0227 vctP 28 4.9 TAATGAGAATAAGTATCAAAA
VCA0063 ptrB -76 5.7 AAATGATAATTGATCTTATTT
VC0877 null 20 4.9 AATTAATAATTATTCTCAAGG
VC1687 ppaC -143 5.1 AGTTGAGAACTATTCGCAATT
VCA0575 VCA0575 -178 5.7 TAATGATAATTGCTATCATTT
VC0074 VC0074 -29 4.5 GTCTGAGAATAATTCGTATTT
VC1572 VC1572 -40 5.6 ATGTGATAATAATTATCATTT
VC0200 fhuA -54 5.2 AATTGAGAAAGATTCGCAATT
VC0200 fhuA -24 4.5 TAATTAAGATAATTATCACTA
Vibrio vulnificus CMCP6
VV1_0149 feoA -42 5.5 TAATAAAAATATTTCTCATTT
VV20839 VV20839 -133 5.5 TAATGATATACATTCTCATTT
VV20843 viuA -299 5 AAATGAGAATGCTTTACATTT
VV21506 null -79 5.9 AATTGATATTCATTCTCATTT
VV21011 fhuC -81 4.8 TTATGAAAACAATTCTCATTG
VV21010 VV21010 -75 5.1 AAATGAGAATCAATTGTAATA
VV20793 VV20793 -95 4.8 AAATGATATAAACTTGCATTT
VV20793 VV20793 -78 5.5 ATTTGATAATAATTTTCATTT
VV20569 VCA1041 -57 6.2 AAATGATATTTATTATCATTT
VV1_1167 COG3315 -55 5.9 AATTGAGATTTATTATCATTA
VV1_2889 PF11449 -62 5.5 TATTGCGAATAATTCTCACTT
VV1_2889 PF11449 -36 6 TAATGATAATCATTCTTATTT
VV20831 vibF -8 6.1 AAATGATAATGATTATTATTA
VV20831 vibF -176 5.8 TAATGATAATTATTATCGTTA
VV20831 vibF -182 4.8 TAATGTTAATGATAATTATTA
VV20115 VCA0743 -336 5.1 TATCAATAATAATTCTCATTC
VV1_1252 sodA -58 5.6 AGTTGATAATGGTTATCATTA
VV1_3101 PF10952 -56 5.7 ACATGATAATAATTTTCATTT
VV21338 VV21338 -154 5.5 AAATGATAACCATTCTCTTTT
VV21615 hutW -108 5.6 AAATAAGATCAATTATCAATT
VV20844 vibH -79 5.6 AATTGATAACTATTATCATTG
VV20834 VC0774 -122 5.8 TAACGATAATAATTATCATTA
VV20834 VC0774 -128 4.7 AAATGCTAACGATAATAATTA
VV20568 VV20568 -317 6.2 AAATGATAATAAATATCATTT
VV1_1340 bfd -57 5.5 TAATGATAATGATTATCTATT
VV21555 torS -49 5.2 CAATAATATTCATTCTCATTA
VV20835 VC0773 -264 4.7 TAATTATTATCGTTAGCATTT
VV20835 VC0773 -270 5.8 TAATGATAATTATTATCGTTA
VV1_1660 fbpA -42 5.2 TACTGATAAACGTTATCATTA
VV1_2968 irpA -38 5.5 AAATAAGAATAATTAGCACTA
VV20364 PF11932 -58 5.7 TAATGCGAATAAATATCATTT
VV21614 tonB-hmu -115 5.6 AATTGATAATTGATCTTATTT
VV1_3034 nrfB -144 5.2 AAATAAGAATTGATGTCATTT
VV1_3034 nrfB -76 5.5 AATTGAAAATGATTCTTAATT
VV20841 null -113 5.5 AAATGGTAATAATAATCATTT
VV21548 ptrB -155 5.8 AATTGATATCTATTCTCATTT
VV21548 ptrB -103 5.3 AAATGATAATTGATGTTATTT
VV1_2020 COG3016 -114 5.5 TAAAGAGAATTATTCTCATTA
VV21178 VV21178 -41 6.4 AAATGATAATAATTATCATTA
VV21178 VV21178 -38 4.4 TGATAATAATTATCATTATAT
VV1_2888 ppaC -163 6 AAATAAGAATGATTATCATTA
VV1_2888 ppaC -137 5.5 AAGTGAGAATTATTCGCAATA
VV20277 VCA0575 -145 5.5 TAATGATAATTACTATCATTC
VV1_1113 VC0074 -66 5.2 AACTAAGAATTATTATTATTC
VV1_2646 VV1_2646 -23 5 AAATAGGACTTATTCTCATTA
VV21016 iutA -145 5.3 AAAAGAAAATAATTCGCATTT
VV21016 iutA -97 5.3 CAATAATAACAATTCTTATTT
VV21337 fhuA -47 5.4 AAATGAGAATTACTACCATTA
VV1_0966 COG2132 -183 5.2 TGTTGAGAATGATTATTAATA
Vibrio harveyi ATCC BAA-1116
VIBHAR_02109 VV20830 -111 5.1 AAATGATAATTAATCCTATCA
VIBHAR_02101 vibF -63 4.4 AAATGATTATTGTTTGCAAAA
VIBHAR_02989 PF10952 -58 5.3 ACTTGATAATAATTATCGTTT
VIBHAR_01363 feoA -42 5.7 TAATAATAATATTTATCATTA
VIBHAR_01398 VC0773 -50 5.3 AAATGAGAAGGGATCTCATTT
VIBHAR_06888 null -48 4.9 AATTGATATACATTCTCTTTT
VIBHAR_00151 sodA -51 4.8 TAATGATTTTCATTAACATTA
VIBHAR_00151 sodA -57 5.5 AGTTGATAATGATTTTCATTA
VIBHAR_05245 hutW -109 5.6 AAATAAGATCAATTATCAATT
VIBHAR_05245 hutW -154 5.3 TATTGCTAATCATTATCAACT
VIBHAR_06273 VCA1041 -93 4.6 AATTGAGAACCATTTACATTG
VIBHAR_00267 COG3315 -57 5.5 TATTGAGATTTATTATCATCT
VIBHAR_01859 PF11449 -36 5.9 TAATGAGAATTATTACCATTT
VIBHAR_01859 PF11449 -62 5.5 TATTGCGAATAATTCTCACTT
VIBHAR_06129 VCA0743 -305 4.4 TAATAATTCTCATTTTCAATA
VIBHAR_02101 vibF -69 4.6 TATTGTAAATGATTATTGTTT
VIBHAR_03638 VC0426 -60 6 TAATGATAATAATTCTCAATA
VIBHAR_06129 VCA0743 -311 6 AATTAATAATAATTCTCATTT
VIBHAR_00053 bfd -58 4.5 TAACAAGAACGATTCTTGTTT
VIBHAR_02532 COG2910 -46 4.5 TGATGTAAAGTATTCTCATTA
VIBHAR_05789 hutA -81 5.2 GAATGATAGTAATTACCATTT
VIBHAR_01762 viuA -134 5.2 AAATGATAATTATTGATATTT
VIBHAR_06301 null -2 4.9 AAATGAGAATTAGTTTCGTTA
VIBHAR_01763 VIBHAR_01763 -29 5.2 AAATATCAATAATTATCATTT
VIBHAR_06272 VV20568 -197 4.6 CAATGTAAATGGTTCTCAATT
VIBHAR_05136 torS -2 5.3 AAATGATAATAGTTATAATCT
VIBHAR_01398 VC0773 -113 5 GAGTGATAATTATTATCAAAA
VIBHAR_01398 VC0773 -119 4.6 TAATGCGAGTGATAATTATTA
VIBHAR_04897 mntH -66 5.3 AGGTGATATTGATTCTCATTT
VIBHAR_05095 VV20793 -50 5.8 AATTGATAATTAATTTCATTT
VIBHAR_05095 VV20793 -73 4.8 AAATGAAAACAAGTCGCACTT
VIBHAR_03435 fbpA -41 5.3 AACTGATAAACGTTATCATTA
VIBHAR_02715 irpA -51 5.5 AAATAAGAATAATTAGCACTA
VIBHAR_06761 fhuE -97 5.4 AAATGGTAATAGTTGTCATTT
VIBHAR_05244 tonB-hmu -79 5.6 AATTGATAATTGATCTTATTT
VIBHAR_05244 tonB-hmu -34 5.3 AGTTGATAATGATTAGCAATA
VIBHAR_02726 nrfB -118 5.2 AAATAAGAATTGATGTCATTT
VIBHAR_02726 nrfB -46 5.9 AATTGAGAATAGTTATCAATT
VIBHAR_06920 VIBHAR_06920 4 4.4 GAAAGAGAATTGTTATCAAAA
VIBHAR_06920 viuB 4 4.4 GAAAGAGAATTGTTATCAAAA
VIBHAR_06135 vctP -31 4.7 GCATGATAACGGATCTCATTA
VIBHAR_02108 vctD -320 5.1 TGATAGGATTAATTATCATTT
VIBHAR_05127 ptrB -80 5.9 AAATGATAATTGATCTCATTT
VIBHAR_03251 null -81 5.1 AATTAATAATCATTCTCAAAA
VIBHAR_03054 COG3016 -80 5.4 TAACGCTAATTATTCTCATTA
VIBHAR_07043 VV21178 -46 5 TAATGATAATGATAATGATTA
VIBHAR_07043 VV21178 -40 5.7 TAATGATAATGATTATCTTTT
VIBHAR_01860 ppaC -191 5.9 AAATGGTAATAATTCTCATTA
VIBHAR_01860 ppaC -165 5.5 AAGTGAGAATTATTCGCAATA
VIBHAR_05788 VCA0575 -173 5.2 AAATGGTAATTACTATCATTC
VIBHAR_00530 VC0074 -78 5.5 AACTAAGAATTATTATTATTA
VIBHAR_02349 VV1_2646 -24 4.9 TAATAGGACTTATTCTCAATT
VIBHAR_00162 VC1572 -41 6.1 TATTGATAATAATTATCATTA
VIBHAR_00162 VC1572 -38 4.5 TGATAATAATTATCATTATCT
VIBHAR_06007 fepB -95 5 TATTGATATTACTTCTCAGTT
VIBHAR_06299 fhuA -48 5.6 AAATGAGATTTATTACTATTT
VIBHAR_03036 null -41 5.7 AATTGATAATGATTTTCAATA
VIBHAR_03036 null -35 5 TAATGATTTTCAATATCAATT
VIBHAR_00368 COG2132 -65 5.4 AACTGAGAATCATTATTAATA
Vibrio parahaemolyticus RIMD 2210633
VPA0882 null -80 5.7 TAATGATAGTAATTATTATTT
VPA0882 null -64 4.4 TATTTAGATCCATTAACATTT
VP0857 feoA -36 4.4 TAATATTTATCATTAGCAATA
VP0857 feoA -42 5.8 AAATAATAATATTTATCATTA
VP2110 PF10952 -57 5.3 ACTTGATAATAATTATCGTTT
VP2860 sodA -58 5 AGTTGATAATGACTTTCATTA
VPA0666 VCA0743 -216 4.4 TAATAAGTAAAGTTATCAGTA
VP1164 PF11449 -30 4.5 TAATTATTACCATTTGCATTT
VP1164 PF11449 -62 5.5 TATTGCGAATAAATCTCATTT
VP1164 PF11449 -36 6 TAATGATAATTATTACCATTT
VPA0427 hutW -109 5.6 AAATAAGATCAATTATCAATT
VPA0535 VCA1041 -99 5 AATTGAGAACCATTTACATTA
VPA0882 null -86 4.7 AAATGATAATGATAGTAATTA
VP0857 feoA -242 4.8 AGATAATATTTATTCTGATTA
VP2944 COG3315 -2 5.6 AATTGATATTCATTATCATCT
VP2647 VC0426 -58 5.1 TAATGAGAAGTATTATCGATA
VP2602 irgA -33 6 AAATAATAATCATTATCAATT
VP2769 bfd -59 4.4 TAACAAGAACCATTCCCGTTT
VPA1434 null -109 5.5 TAATTGTAATTATTATCATTT
VP0857 feoA -42 5.8 AAATAATAATATTTATCATTA
VPA0663 null -2 5.4 TAATGATAATAATTCTCAGGT
VP2603 irgB -124 6 AATTGATAATGATTATTATTT
VPA0536 VV20568 -252 5 TAATGTAAATGGTTCTCAATT
VPA1658 VPA1658 -208 5.5 AAATAAGAACAAATATTATTT
VPA1462 torS -40 4.5 TAATAATAATGATAATAATCA
VPA1494 VV20793 -57 5.7 AATTGATAATCAATTTCATTT
VPA1494 VV20793 -80 4.8 AAATGAAAACAATACGCACTT
VP2491 fbpA -40 5.3 AACTGATAAACGTTATCATTA
VP1920 irpA -33 5.5 AAATAAGAATAATTAGCACTA
VPA0150 fhuE -98 5.3 AAATGGTAATACTTATCACTT
VPA0426 tonB-hmu -74 5.6 AATTGATAATTGATCTTATTT
VP1928 nrfB -140 5.2 AAATAAGAATTGATGTCATTT
VP1928 nrfB -70 5.3 AGTTGAGAACAGTTATCAATT
VPA1467 ptrB -79 5.9 AAATGATAATTGATCTCATTT
VP2332 null -81 5.3 AATTAATAATCATTCCCAATA
VP2161 COG3016 -80 5.5 TAACGAAAATCATTCTCATTT
VPA0004 VV21178 -2 5.8 TAATGATAATAATTATCTTTT
VP1165 ppaC -185 4.5 AAATGCAAATGGTAATAATTA
VP1165 ppaC -179 6 AAATGGTAATAATTATCATTA
VP1165 ppaC -153 5.5 AAATGAGATTTATTCGCAATA
VPA0883 VCA0575 -189 4.4 AAATGTTAATGGATCTAAATA
VPA0883 VCA0575 -173 5.7 AAATAATAATTACTATCATTA
VPA0883 VCA0575 -167 4.7 TAATTACTATCATTATCATTT
VP0074 VC0074 -66 5.6 AACTAAGAATTATTATTATTT
VPA0657 vctP -33 5 GCATGATAATAGATCTCATTA
VP1609 VV1_2646 -24 5 AAATAGGACTTATTCTCAATT
VP2872 VC1572 -41 6.2 AATTGATAATAATTATCATTA
VP2872 VC1572 -38 4.5 TGATAATAATTATCATTATCT
VPA0979 iutA -55 5.1 TATTGATAATAAGTATCATTG
VPA1657 fepA -60 5.5 AAATAATATTTGTTCTTATTT
VPA1435 fhuA -57 5.5 AAATGATAATAATTACAATTA
VP2146 PF00106 -204 5.9 AATTGATAATGATTTTCATTA
VPA0157 PF03929 -59 4.9 CAATAAGAATGATTATCACCT
Vibrio shilonii AK1
VSAK1_03309 COG4771 -39 5.8 AAATGCAAACTATTATCATTT
VSAK1_09003 feoA -45 5.2 TAATGTTAATATTTCTCATTA
VSAK1_03314 null -102 5.8 AAATGATAATAGTTTGCATTT
VSAK1_03499 COG0778 -87 5.1 GATTGAGAACAGTTCTCACTT
VSAK1_20819 PF10952 -148 5 AAATGATAATCGTTATCGAAT
VSAK1_23799 hutA -84 5.5 AAATAATAATACATATCATTT
VSAK1_26775 null -52 5.5 AAATGAAAGTAATTATCAATA
VSAK1_26775 null -46 4.4 AAGTAATTATCAATAACATTT
VSAK1_06125 VV20793 -40 5.5 AAATGATATTTATTTGCAATT
VSAK1_06125 VV20793 -23 4.6 AATTGATTCTAATTTGCATTT
VSAK1_17622 VCA1041 -98 4.4 TAATGATATTGAGAGTCATTT
VSAK1_17632 VV20793 -73 5.1 AAATGATAATTACTTGCATTC
VSAK1_13246 COG3315 -2 5.5 AAATGACATTAGTTATCATTT
VSAK1_04382 PF11449 -63 5.1 CATTGAGAATTATTCTCATAT
VSAK1_04382 PF11449 -37 6.3 TAATGATAATAATTCTCATTT
VSAK1_15507 mntH -67 5.4 AGATGCGATTGATTATCATTT
VSAK1_22234 hutW -107 5.6 AAATAAGATCAATTATCAATT
VSAK1_16967 null -42 4.8 TATTAATAATAAAACTTATTA
VSAK1_10253 VC0426 -70 4.9 GATTGATTTTAATTCTCATTA
VSAK1_20819 PF10952 -55 5.7 AAATGATAATCAATATCATCT
VSAK1_11298 frdA -256 4.9 AAATCATAATTAAACTCATTA
VSAK1_18252 null -78 6.3 TAATGATAATGATTATCATTT
VSAK1_18252 null -72 4.5 TAATGATTATCATTTTAATCT
VSAK1_01252 COG2910 -18 4.6 AAATTATTATCATTATCAATG
VSAK1_01252 COG2910 -24 5.1 TAGTGTAAATTATTATCATTA
VSAK1_18187 VSAK1_18187 -64 5.6 TAATGACAATAGTTATCATTA
VSAK1_04950 VSAK1_04950 -108 5.8 AAATGATAATAAATAGCATTA
VSAK1_04580 irpA -55 5.7 AAATGATAATAATTCGCACTA
VSAK1_26760 PF11932 -225 5.3 AAATGATAACTCATATCAATA
VSAK1_22229 tonB-hmu -78 5.6 AATTGATAATTGATCTTATTT
VSAK1_05595 nrfB -274 5.7 TGATGATATTAATTATCATTT
VSAK1_05595 nrfB -125 4.9 AAATAAGAATTGATTACATTT
VSAK1_05955 VIBHAR_06920 -31 5.4 AAATGAAAACAATAATCATTA
VSAK1_05955 viuB -31 5.4 AAATGAAAACAATAATCATTA
VSAK1_21214 vctP -79 5.6 AAATGATATTGATTCCCATTT
VSAK1_21214 vctP -52 4.7 AAGTGATAATGATTCTGTTTA
VSAK1_04387 ppaC -192 6.3 AAATGAGAATTATTATCATTA
VSAK1_04387 ppaC -166 5.1 ATATGAGAATAATTCTCAATG
VSAK1_14737 VSAK1_14737 -108 4.6 AGATGAAAATAATTGCCACTA
VSAK1_14737 VSAK1_14737 -77 5.4 AAATGATAGTAATTCGTATTT
VSAK1_12905 VC0074 -47 4.5 AACTAAGAATCATTCCTGTTT
VSAK1_05315 VV1_2646 -23 4.6 TAATAGGAACTATTCTCAAAA
VSAK1_20974 iutA -112 5.9 AAATAGTAATAATTATCATTT
VSAK1_22029 fepB -76 4.4 TAATAGTATTGATAACCATTA
VSAK1_22029 fepB -70 5.3 TATTGATAACCATTATTGTTT
VSAK1_22009 fepA -69 5.2 TATTGATAACTATTATCAAAA
VSAK1_05600 nrfA -241 5.7 AAATGATAATTAATATCATCA
VSAK1_24319 COG2132 -44 4.8 AATTGAGAATCATTATCTAAT
Vibrio splendidus LGP32
VS_0939 COG0778 -76 4.5 CGTTGAGATTTATTATCGTTT
VS_2918 sodA -58 5.1 AGTTGATAATGATTTCCATTA
VS_2918 sodA -52 5.2 TAATGATTTCCATTATCATTA
VS_II0548 VCA0743 -251 5 ATACAAGAATAATTATCAATT
VS_2234 feoA -42 5 TAATAACAATCTTTCTCATTA
VS_3005 COG3315 -43 5.6 AATTGATATTCATTATCATCT
VS_II1376 VV20793 -72 4.6 GAATGATTTTAATTTGCAATT
VS_II1376 VV20793 -55 6 AATTGATAATAAATATCATTA
VS_II1376 VV20793 -49 4.7 TAATAAATATCATTAACATTT
VS_1901 iscA -102 4.5 ATATGCAAATGATAATCAATA
VS_2112 fhuC -73 4.4 GAATAATTATCATTTTGATTT
VS_0969 PF10952 -56 6 ACATGATAATAATTATCATTT
VS_0969 PF10952 -105 4.4 AATCGATATTCTTTACTAATT
VS_0969 PF10952 -112 4.6 TATTAATAATCGATATTCTTT
VS_2395 COG4771 -88 5.5 AAATGATAACCATTACTATTA
VS_2002 PF11449 -61 5.9 AATTGATAATTATTATCATTC
VS_2002 PF11449 -67 4.4 GAATGCAATTGATAATTATTA
VS_II0290 hutW -108 5.6 AAATAAGATCAATTATCAATT
VS_II0364 VCA1041 -63 5.8 AAATGATAATCAGTATCATTT
VS_3005 COG3315 -76 5.1 TATTGATATTTACTCTCAATA
VS_2112 fhuC -79 4.7 TTTAGCGAATAATTATCATTT
VS_1901 iscA -96 5.7 AAATGATAATCAATATCATCT
VS_1901 iscA -207 5.8 TAATGATAATCATTATTAATA
VS_II0412 viuB -76 5.3 AAATGATAACTATTAGTATTG
VS_1123 viuP -98 5 AAATGAGAATCAATGTAATTT
VS_2111 PF07690 -49 4.4 AAATCAAAATGATAATTATTC
VS_2111 PF07690 -43 4.7 AAATGATAATTATTCGCTAAA
VS_II0661 azu1 -27 5.3 TGTTGAAAATAATTCTTATTT
VS_1633 VSAK1_18187 -46 5.5 TAATGCAAACCATTATCATTA
VS_1633 VSAK1_18187 -17 4.9 ATATAAGAATAAATATCATGT
VS_II0528 null -2 5.9 AAATGATAATAATTATCAATC
VS_II0500 VV21338 -244 4.6 AAATGAGAATCAGTTGCGTTA
VS_II1129 VPA1658 -211 5.4 GAATAAGAACAAATATCATTT
VS_2518 fbpA -41 5.1 AACTGATAGACATTATCATTT
VS_1923 irpA -61 5.3 AAATGATAATGGTTTGCACTA
VS_II0677 fhuE -124 5.4 AAATAGTAATAGTTATCACTT
VS_II0678 PF11932 -61 4.9 TAATGAGACTGCTTATCAATA
VS_II0289 tonB-hmu -67 5.6 AATTGATAATTGATCTTATTT
VS_1932 nrfB -263 5.4 AACTGAGAATTATTATCATAT
VS_1932 nrfB -113 5.7 AAATAAGAATTGATATCATTT
VS_II0412 VIBHAR_06920 -76 5.3 AAATGATAACTATTAGTATTG
VS_2367 null -81 5.7 AAATGATAATTATTATCAAAA
VS_II1528 VV21178 -31 5.9 TAATGATAATAGTTATCAATA
VS_2001 ppaC -161 5.9 GAATGATAATAATTATCAATT
VS_2001 ppaC -155 4.4 TAATAATTATCAATTGCATTC
VS_0088 VC0074 -38 5.1 AACTAAGAATCATTATTATTC
VS_II1071 vctP -129 5.7 AATTGATAATAGTTCTCACTT
VS_1414 VV1_2646 -23 5 AAATAGGACTTATTCTCATTA
VS_2936 VC1572 -45 5.7 ATTTGATAATAATTATCATTA
VS_2936 VC1572 -39 4.5 TAATAATTATCATTAACATTC
VS_2116 iutA -298 5.4 CAATAATAATGATTCTTATTT
VS_2116 iutA -263 4.6 TAACGATAATACTTCGTACTT
VS_II1128 fepA -60 5.4 AAATGATATTTGTTCTTATTC
VS_II0501 fhuA -49 5.6 AAATGAGATTTATTACTATTT
VS_0942 PF00106 -197 6.1 TAATGATAATAGTTATCATTA
VS_1933 nrfA -281 5.4 ATATGATAATAATTCTCAGTT
VS_3101 COG2132 -62 5.4 TTATGAGAATTATTCTCAATA
VS_II0685 PF03929 -57 4.8 CAATACGAATTATTATCAACT
Vibrio fischeri ES114
VF_1234 hutA -69 4.4 TAGTAATTATCATTCGTAATA
VF_A0158 fhuC -31 5.6 GAATAAAAATAATTATCATTA
VF_2151 fbpA -53 5.9 TATTGATAATTATTATTATTA
VF_1234 hutA -81 4.4 AAATGAAAATGATAGTAATTA
VF_1226 hutW -100 5.7 TAATGAGATCAATTATCAATT
VF_0833 feoA -35 5.7 AAATAATAATGATTCTCACTA
VF_1056 VCA1041 -59 5.8 AATTGATAATGTTTATCATTT
VF_1234 hutA -75 5.6 AAATGATAGTAATTATCATTC
VF_A0848 PF11449 -39 5.3 TACTAATAATCATTCGCATTT
VF_A0848 PF11449 -65 5.8 AGTTGATAATAATTCTCATTT
VF_A0848 PF11449 -72 4.6 AAATGATAGTTGATAATAATT
VF_0927 PF10952 -70 5.8 AATTGATAATAATTCTCAGTT
VF_2441 COG3315 -47 5.9 TAATGATAGTTATTATCATTT
VF_2441 COG3315 -53 4.4 AAGTGGTAATGATAGTTATTA
VF_2334 frdA -298 5.3 CAATAAGAATCATTATCACTT
VF_A0158 fhuC -25 5 AAATAATTATCATTAACATTT
VF_A0157 PF07690 -76 5.6 TAATGATAATTATTTTTATTC
VF_A0157 PF07690 -82 5 AAATGTTAATGATAATTATTT
VF_2151 fbpA -47 4.9 TAATTATTATTATTACCATTT
VF_1190 irpA -132 5.4 AAATGATAAGGATTTGCATTT
VF_1190 irpA -87 5.9 AAATAAAAATTATTATCATTA
VF_A0191 fhuE -83 5.9 AAATGGTAACAATTATCATTT
VF_1225 tonB-hmu -65 5.7 AATTGATAATTGATCTCATTA
VF_1553 nrfB -264 5.6 TATTAAGAATGATTCTTATTT
VF_A0827 vctP -65 5.6 TAATAATAACCATTTTCATTA
VF_A0827 vctP -34 5.4 AAATACGAATAGTTATCACTT
VF_A0333 ptrB -85 4.4 AAATGAAAATGATAATTGATC
VF_A0333 ptrB -79 5.5 AAATGATAATTGATCTCATTC
VF_A0827 vctP -65 5.6 TAATAATAACCATTTTCATTA
VF_A0827 vctP -34 5.4 AAATACGAATAGTTATCACTT
VF_A0756 COG3016 -82 5.5 TACTGAGAATGATTCTTATTT
VF_A0756 COG3016 -66 4.7 TATTTATATTGATAATCATTT
VF_A0756 COG3016 -60 5.5 TATTGATAATCATTTCCATTT
VF_A0200 VV21178 -44 5 TGATAATAATGATAATCATTA
VF_A0200 VV21178 -38 5.3 TAATGATAATCATTATCTTTC
VF_1277 VV1_2646 -26 4.4 AGATAATAATAGGAATCATTA
VF_1277 VV1_2646 -20 5.2 TAATAGGAATCATTATCACTA
VF_A0161 iucA -52 5.5 TAATGAGAATCATTAGCATTC
VF_A0165 iutA -62 4.5 GAATACGGATTTTTATCATTT
VF_A0784 fhuA -55 4.7 GCAAGAGAATCATTCTCATTT
VF_1554 nrfA -226 5.6 AAATAAGAATCATTCTTAATA
Vibrio salmonicida LFI1238
VSAL_I1750 hutW -147 5.8 AAATGAGATCAATTATCAATT
VSAL_II0150 fhuC -75 4.6 AAACAATTATCATTACTATTT
VSAL_I2588 fbpA -53 5.4 TATTGATAAGTATTCTTATTA
VSAL_I0884 null -50 5.4 AATTGATATAAGTTCTCATTT
VSAL_II0074 PF11449 -39 5.3 TACTAATAATCATTCGCATTT
VSAL_II0074 PF11449 -72 4.6 AAATGATAGTTGATAATAATT
VSAL_II0074 PF11449 -65 5.8 AGTTGATAATAATTCTCATTT
pVSAL320_27 null -66 5.7 AAATGAGATTCATTATTATTA
VSAL_I1864 PF10952 -61 6.1 TAATGATAATAATTCTCAATT
VSAL_I2892 COG3315 -34 5.4 TAATGATAGTCATTATCATCT
VSAL_I2892 COG3315 -40 4.7 AATTGGTAATGATAGTCATTA
VSAL_I2788 frdA -256 4.9 CGATAAGAATCATTATCACTT
VSAL_II0150 fhuC -81 5.4 GAATAAAAACAATTATCATTA
VSAL_I2257 feoA -35 5.7 AAATAATAATGATTCTCACTA
VSAL_II0573 VIBHAR_01767 -30 5 AAATAAGAATAATTACTAAGT
VSAL_II0149 PF07690 -150 4.6 AAATAGTAATGATAATTGTTT
VSAL_II0149 PF07690 -144 5.4 TAATGATAATTGTTTTTATTC
VSAL_I1786 irpA -83 5.7 AAATAACAATAATTATCATTA
VSAL_I1786 irpA -128 5.5 TAATGATAAATATTTGCATTT
VSAL_II0110 fhuE -82 5.8 AAATAAAAACGATTATCATTT
VSAL_I1998 nrfB -286 5.5 TATTAATAATGGTTCTTATTT
VSAL_I1998 nrfB -127 4.5 CAATGAGAATTGATTTCAATG
VSAL_I0891 null -89 5.2 AATTGCGAACTATTATCATAT
VSAL_II0868 COG3016 -82 5.2 AGTTGATAATGATTACTATTA
VSAL_I1541 VV1_2646 -20 5 TAATAGGAATCATTCTCATTG
VSAL_II0909 fhuA -56 4.7 GCAAGAGAATCATTCTCATTT
VSAL_I1997 nrfA -227 5.5 AAATAAGAACCATTATTAATA
VSAL_II0118 PF03929 -61 4.7 CAACGCAAATCATTATCAATT
Vibrio angustum S14
VAS14_17796 feoA -36 5.8 AAATGCTAATAATTCTTATTA
VAS14_10719 COG2910 -48 5.6 TAATGCAAACTATTATCATTA
VAS14_05758 COG0778 -30 5.3 AAAAAATAACTATTTTCATTT
VAS14_12039 mntH -61 5.6 AAATGACATTGATTATCATTT
VAS14_20031 fbpA -46 5.6 TATTGAGAAACATTATCATTA
VAS14_03953 huvX -206 5.4 GAATAATATCAATTATCATTT
VAS14_13349 null -116 4.6 ATATAGTAATAAGTCTCATTA
VAS14_13349 null -53 5.8 TAACGATAATTATTATCATTA
VAS14_13784 VCA1041 -123 5.5 TAATGCGAATGTTTATCATTT
VAS14_04118 feoB -82 5.1 AAGTGATAAGCGATATCATTT
VAS14_08970 null -74 5.3 TAATGATTACCATTCTCATTA
VAS14_05603 sodA -55 6.1 TAATGATAATAGTTATCATTA
VAS14_21832 COG3315 -42 5.7 AACTGATAATTATTATCATCT
VAS14_10539 sitA -83 4.8 TAATAATTATCAATTGCATTT
VAS14_10539 sitA -89 6.1 TATTGATAATAATTATCAATT
VAS14_13349 null -47 5 TAATTATTATCATTATTATTT
VAS14_12284 VSAK1_04950 -27 5.6 AAATGATAATTCATCTCATTT
VAS14_01246 irpA -73 5.7 TAATAATAACAATTATCACTT
VAS14_01246 irpA -141 5.5 AAATGCAAATTATTACCATTA
VAS14_12509 fhuE -189 5.5 AAATGGTAATGGTTATCACTT
VAS14_03958 tonB-hmu -190 5.4 AAATGATAATTGATATTATTC
VAS14_04423 VIBHAR_06920 -29 5.5 AAATAAAAACCATTCTCAATT
VAS14_04423 viuB -29 5.5 AAATAAAAACCATTCTCAATT
VAS14_06553 COG3016 -93 5.2 AATTGATAATAACTCGTATTA
VAS14_10859 VV21178 -53 5.4 TAATGATAATAAGTTTCATTA
VAS14_10859 VV21178 -47 4.7 TAATAAGTTTCATTATCATGT
VAS14_03678 VSAK1_14737 -80 5.5 AAATGATAGTAATTATCGTTT
VAS14_22809 VC0074 -62 5.2 AATTACGAATCATTATCGTTT
VAS14_02953 VV1_2646 -60 4.7 AAATGAAAACACTTAACAATA
VAS14_02953 VV1_2646 -41 4.8 TAATAGGAATCATTATCACTG
VAS14_13589 VC1572 -98 5.6 AGATGATAATAATTATCAGTA
VAS14_13589 VC1572 -92 4.5 TAATAATTATCAGTAGCAATT
VAS14_13589 VC1572 -44 5.6 CAATGATAATGATTATCAATA
VAS14_15544 fepA -70 5.6 AAGTGATAATTATTTGCATTA
VAS14_10544 PF00106 -128 6.1 AATTGATAATTATTATCAATA
VAS14_12444 PF03929 -61 5.2 CAATAAGAACGATTATCAATT
Photobacterium profundum SS9
PBPRA2593 COG0778 -19 4.3 TTGTAAGAGCAATTATTATTT
PBPRA2102 hutW -287 5.8 AAATAAGATTGATTATCATTT
PBPRB1034 null -141 4.9 TAATACAAATAATAATTATTT
PBPRB1812 viuB -45 5.9 AAATGATAATGGTTTTCATTA
PBPRB1034 null -135 5.9 AAATAATAATTATTTTCATTA
PBPRA2102 hutW -342 5.4 GAATAATATCAATTATCATTT
PBPRA3184 fbpA -2 5.5 TATTGATAATTGTTATCATTG
PBPRB1817 fecB -69 5.3 AAATAAAAATAGTTATCAATC
PBPRB1905 feoA -97 5.2 AAACTATAATAGTTATCATTT
PBPRA1535 hutA -79 5.3 TAACGATAGTAATTCTCATTT
PBPRB0614 VCA1041 -63 5.7 TAATGCGAATGAATATCATTT
PBPRB2013 PF11449 -77 5.7 ACTTGATAATAATTCTCATTT
PBPRB2013 PF11449 -71 4.4 TAATAATTCTCATTTGCATTT
PBPRB1172 VV20793 -54 5.9 AATTGATAATGAATATCATTA
PBPRA1058 feoA -36 5.6 AAATACTAATAATTCTTATTA
PBPRA1567 null -160 5.4 TAATGATAATGATTGTCATCT
PBPRA2569 sodA -54 5.4 TAATGCGAGTAATTATCATTA
PBPRA0166 COG3315 -45 5.4 TAATGATAGTCATTATCATCT
PBPRB1816 PBPRB1816 -121 5.3 GATTGATAACTATTTTTATTT
PBPRB1864 COG2910 -46 4.6 TAATACGAATTAGAATCATTA
PBPRB1825 COG4771 -43 5.5 TAACGATAATAATTATCATTC
PBPRA0317 bfd -59 5.1 AAATGCAAACGATTCTCGTTT
PBPRB0694 PF11932 -98 5.6 AAATGAGATTCATTTTCAATT
PBPRB0694 PF11932 -20 4.4 AAATACTATTGATGAGCAATA
PBPRB1222 fhuE -160 5.7 AAATGCTAACAATTATCACTT
PBPRA2103 tonB-hmu -196 5.8 AAATGATAATCAATCTTATTT
PBPRA2103 tonB-hmu -141 5.4 AAATGATAATTGATATTATTC
PBPRA1259 nrfB -208 4.8 TAATGAGAATGGGTGTCAATT
PBPRA1259 nrfB -191 5.1 AATTGCAAATGGTTTTTATTT
PBPRB0979 ptrB -73 5 AAATGAGAATCATTCTTGATC
PBPRA2792 COG3016 -190 5.4 TATTGATATTGATTATCAGTT
PBPRA2792 COG3016 -167 4.9 ATTTGATAATCAATATCAACT
PBPRA3532 VC0074 -19 5.2 AACTGATAATGATTAGCGTTT
PBPRA1566 fhuA -138 4.7 CAATGATAGTAGTTATCATTG
PBPRB1213 PF03929 -87 5.3 CAATGAAAACGATTATCAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD