Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlcC in Rhodobacterales

Properties
Regulator family: GntR/Others
Regulation mode: activator (repressor)
Biological process: Glycolate utilization
Effector: Glycolate
Regulog: GlcC - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Paracoccus denitrificans PD1222
Pden_4399 glcD -71 6.1 ATGTGGTCTGAAAATTATACCAAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD