Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlcC in Rhizobiales

Properties
Regulator family: GntR/Others
Regulation mode: activator (repressor)
Biological process: Glycolate utilization
Effector: Glycolate
Regulog: GlcC - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc00832 glcD -46 5.8 TAGTGGTAAGCAAAAAATACCACTT
SMc00830 mlr6914 -130 5.7 AAGTGGTCAAATTGATTGTCCACTC
SMc00831 lysR -178 4.7 AAGTGGTATTTTTTGCTTACCACTA
SMb20850 lldD -100 4.1 GAGAGGTAAGATTTTTTGACCTCTC
SMc00829 glcC -73 4.9 GAGTGGACAATCAATTTGACCACTT
Rhizobium sp. NGR234
NGR_c03890 glcC -101 5.1 AAGTGGACAATCGATTTGACCACTT
NGR_c23940 lldD -202 4.6 AAGAGGTCAATTTTTTTGACCTCTT
NGR_c03900 mlr6914 -134 6.3 AAGTGGTCAAATCGATTGTCCACTT
Agrobacterium tumefaciens str. C58 (Cereon)
Atu0664 lysR -85 4.9 AACTGGTATTCTTTCTTTACCACTT
Atu0662 glcC -90 4.9 AACTGGATAGAATAATTGACCAGTA
Atu0665 glcD -51 5.6 AAGTGGTAAAGAAAGAATACCAGTT
Mesorhizobium sp. BNC1
Meso_0366 glcC -58 4.1 CATTGGACAAATAAGTTGACCAGTT
Meso_0364 glcD -36 4.7 AACTGGTAAATAGATTAGACCAGTG
Meso_0365 mlr6914 -119 4.2 AACTGGTCAACTTATTTGTCCAATG
Mesorhizobium loti MAFF303099
mll6911 glcC -78 4.6 AATTGGATAAATAATTTGACCAGTT
mlr6914 mlr6914 -156 5.2 AACTGGTCAAATTATTTATCCAATT
mlr6916 glcD -113 4.4 CACTGGTAAAAGATTTTGACCAGTG
Brucella melitensis 16M
BMEII1064 glcD -78 7.9 AAGTGGTAAAAACGATTTACCACTT
BMEII0377 lldD -33 4.6 GATTGGTAAAGAAAACTGACCACAA
BMEII1065 lysR -111 6 AAGTGGTAAATCGTTTTTACCACTT
BMEI1232 lldP -171 4.5 CTCTGGTAAAGTAAGTTTACCAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD