Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Irr in Rhodospirillales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Regulog: Irr - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A1789 ccpA -96 4.3 TTCCTAGAGCAATTCCAATAT
Rru_A2196 bfd -43 4.8 GGTTTTGAGTGGTTTTAATCT
Magnetospirillum magnetotacticum MS-1
Magn03001119 sufS2 -205 5 CTCTTAGAATAATTCTAGACG
Magn03001119 sufS2 -186 6.1 CGATTAGAACTATTCTAAACT
Magn03005274 bfr -156 5.6 AGTTTGGGATCATTCCAAACT
Magn03006487 fhuA -180 4.9 AAATAAGAATAATTCTATACA
Magn03009205 irr -61 4.1 TTTTTCGAACGACTCCATGTT
Magnetospirillum magneticum AMB-1
amb2822 ccpA -164 5.1 GAGTTAGAAGAATTCTAAATA
Azospirillum sp. B510
AZL_001890 ccpA -173 6 AGTTTAGAATAATTCCAGATT
Rhodospirillum centenum SW
RC1_1876 dps1 -63 5.7 AACTTGGAAGAATTCTAAACT
RC1_3428 bfr -48 4.4 GTTTTAAACTCGTTCCAGACT
RC1_3828 ccpA -77 4.6 TCTTTAGATTTATTCAAGATC
RC1_2944 irr -104 4.7 GGCCTTGAATTGTTCCAAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD