Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Irr in Rhodobacterales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Regulog: Irr - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_0850 mbfA -29 5.9 AATTTAGAATGACTCTAAAAA
RSP_2395 ccpA -87 4.9 AGATTAGAATTGATCTAAGTC
Jannaschia sp. CCS1
Jann_2366 iscR -137 5.2 ACCCTAGAACGATTCCAAATT
Jann_0865 fssA -79 4.9 ACTTTAGAACGATTCCAGTTC
Jann_3276 dps -123 6.3 AGTTTAGAATTATTCTAGACA
Rhodobacterales bacterium HTCC2654
RB2654_13154 irpA -46 5.4 TGATTGGAACCATTCCAAATT
RB2654_18613 fssA -52 4.8 GACTTGGAACGATTCCAAGCT
RB2654_16991 mbfA -30 6 AGTTTGGAATCGTTCCAAACA
Oceanicola granulosus HTCC2516
OG2516_03700 iscR -131 6.3 TGTTTAGAAGTGTTCTAAACT
Loktanella vestfoldensis SKA53
SKA53_05183 iscR -111 5.9 ACCTTAGAAGGATTCTAAACT
SKA53_14701 fssA -78 5.9 AGTTTAGAATCGTTCCAAATC
SKA53_14166 mbfA -32 6.1 AGATTAGAATCATTCTAAATA
SKA53_14466 katG -85 4.9 ATGTTAGAAGGATTCTAAGCG
Oceanicola batsensis HTCC2597
OB2597_03589 iscR -114 5 ACCTTAGAAAGATTCTAAAGC
OB2597_10089 fssA -79 5.2 GAATTAGAACGGTTCTAAATC
OB2597_06815 bfr -85 6.1 TTTTTGGAATAATTCTAAATT
Roseovarius nubinhibens ISM
ISM_16015 iscR -129 6.3 ACTTTAGAACTGTTCTAAACA
ISM_02850 fssA -77 5.6 TTTTTAGAATCGTTCCAAATC
ISM_08740 mbfA -39 5.9 AGTTTAGAATCATTCTAATTG
ISM_16225 katG -92 4.6 CGCTTAGAACGATTCCAAGGC
Roseovarius sp. 217
ROS217_20542 iscR -100 6 ACCTTAGAACTGTTCTAAATT
ROS217_10487 fssA -76 5.8 ATCTTAGAATGGTTCTAAACC
ROS217_11126 mbfA -30 6.3 AGTTTAGAATTATTCTAAAAG
ROS217_11501 ccpA -75 5.5 GATTTAGAATGGTTCCAAACG
Sulfitobacter sp. EE-36
EE36_11399 katG -111 4.5 ctgTTAGAAcAATTCcAgAaa
EE36_14302 iscR -116 5.9 AGTTTAGAACGGTTCTAACTT
EE36_09510 fssA -76 5.5 AACTTAGAATCGTTCCAAACC
EE36_01790 dps -116 6.3 AGTTTAGAATAATTCCAAAAA
Silicibacter TM1040
TM1040_1240 iscR -117 5.7 ACCTTAGAACTGTTCTAAAGA
TM1040_3091 fssA -74 5.7 AATTTAGAACCATTCCAAAAC
TM1040_2791 katG -146 5.7 AACTTAGAATAATTCTGAACT
Silicibacter pomeroyi DSS-3
SPO2025 iscR -121 5.2 ATCTTAGAATGGTTCTAAGTC
SPO0382 fssA -76 5.7 TCTTTAGAACCGTTCCAAAGT
SPO3842 mbfA -32 5.8 ATCTTGGAATCATTCTAAATT
SPO0330 ccpA -72 5.3 ATGTTAGAATGATTCTAATCG
Roseobacter sp. MED193
MED193_04321 iscR -124 5.3 ATCTTAGAACAATTCTAATTG
MED193_10358 fssA -75 6.4 AATTTAGAATAATTCTAAACC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD