Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Irr in Rhizobiales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Regulog: Irr - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc01119 fssA -60 6 ATTTTGGAACAATTCTAAAAA
SMc04019 hemH -65 5.4 TTTTTAGAAGGATTTGAAACT
SMc00784 fbpA -148 5.9 AGTTTGGAACAATTCCAAAAA
SMc00402 iprA -118 4.9 AACTTCAAGCCGTTCTAAACT
SMc03787 bfd -119 5.3 AGTTTAGAATCGCTCTAATGC
SMc00529 sufS2 -133 6.2 ACTTTAGAACCGTTCAAAACT
SMc00359 mbfA -31 5.8 TAATTAGAATTATTCTAAAGA
SMc03104 hemA -246 6 ATTTTGGAATGGTTCAAAACT
SMc00785 rirA -72 5.9 TTTTTGGAATTGTTCCAAACT
SMb21432 irp6A -86 5.3 TGTTTGGAAGCGTTCTAAAAG
Rhizobium sp. NGR234
NGR_c00370 fssA -59 6 ATTTTTGAATTATTCTAAAGA
NGR_c36600 iprA -114 5.4 AATTTGAAAATGTTCTAAACT
NGR_c31850 bfd -62 5.4 AGATTAGAACGACTCTAATAT
NGR_c30700 hemA -112 5.7 GTTTTGGAATAGTTCAAAACT
NGR_c03440 fbpA -135 5.6 AGTTTGGAACAATTCCAAAAG
NGR_c36170 mbfA -32 6.1 TCTTTAGAATTATTCTAAAGA
NGR_c23520 hmuR -73 4 TGTTTCAAATTGTGCTGAAAC
NGR_c03450 rirA -72 5.6 CTTTTGGAATTGTTCCAAACT
NGR_b11200 irp6A -86 5.3 TGTTTGGAAGGGTTCTAAAAG
NGR_c28500 hemH -61 5.4 TTTTTAGAAGGATTTGAAACT
NGR_c15400 sufS2 -140 6.2 ACTTTAGAACCGTTCAAAACT
Rhizobium leguminosarum bv. viciae 3841
RL0400 fssA -57 5.4 TCTTTTGAAGCATTCTAAAGA
RL0322 iprA -207 5.3 TTCTTAAAATCATTCCAAACT
RL0263 mbfA -34 6.2 GATTTAGAATTATTCTAAAAT
RL4379 hemA -118 5.4 TATCTGGAATCATTCAAAACT
RL0777 rirA -67 6.1 ATTTTGGAATTGTTCAAAACT
RL2703 fumA -54 4.9 GATTTAGACCGGTTCCAATCT
RL2713 irp6A -92 4.9 AGTTTGGAAACGCTCTAAAAC
RL1432 null -107 5.5 AGTCGAGAACAGTTCTAAACA
RL2583 sufS2 -134 6.6 AGTTTAGAACAATTCGAAACT
Rhizobium etli CFN 42
RHE_CH00304 iprA -99 5.6 ATCTTAAAATTATTCCAAACT
RHE_CH00381 fssA -57 5.4 TCTTTTGAAGAATTCTAAAGA
RHE_CH00257 mbfA -34 6.4 GGTTTAGAATTATTCTAAATT
RHE_CH03846 hemA -118 5.2 TGTCTGGAATCATTCAAAAAA
RHE_CH00735 rirA -69 6.1 ATTTTGGAATTGTTCAAAACT
RHE_CH02385 fumA -156 4.6 CATTTAGATCGGTTCCAATTT
RHE_CH02254 sufS2 -206 6.6 AGTTTAGAACAATTCGAAACT
Agrobacterium tumefaciens str. C58 (Cereon)
Atu2473 fatB -130 5.3 AATTCAGAACCGTTCTAAAAC
Atu0288 iprA -107 5.5 TGTTTCAAAGCATTCTAAACT
Atu4022 fhuA -168 5.6 AGATTTGAATAATTCCAAGCT
Atu0202 fbpA -113 5.7 AGTTTAGAACAATTCCAGAAA
Atu2613 hemA -117 5.2 TTATTGGAATGGTTCAAAACA
Atu0351 fssA -56 5.7 TTTTTGGAAGAATTCTAAATT
Atu0251 mbfA -32 6.2 TATTTAGAATTATTCTAAAAA
Atu0251 mbfA -79 5.4 TTGTTAGAATTATTCTAAAAC
Atu0201 rirA -66 5.7 TTTCTGGAATTGTTCTAAACT
Atu3391 irp6A -89 5.1 AGTTAAGAATGGCTCTAAAAC
Atu3916 irgA -92 5.7 AATTTAGAACTGTTCGAAAAC
Atu1350 fdx -39 5.4 TGTTTAGAACAATTCTCAGAT
Atu1825 sufS2 -125 6.6 AGTTTAGAATAATTCGAAACT
Mesorhizobium sp. BNC1
Meso_0170 fbpA -143 6.9 AGTTTAGAATAATTCTAAACT
Meso_4072 mbfA -37 6.4 AGTTTAGAATTATTCTAATCA
Meso_1782 sufS2 -131 6.5 AGTTTAGAACTGTTCAAAACT
Meso_4037 fssA -44 6 ATTTTAGAATTGTTCCAAAAA
Mesorhizobium loti MAFF303099
mlr6940 katG -22 5.1 AGTCTGGAATCGTTCCAGATT
mll4333 ccmA -86 5 TTTCTGGAATAGTTCTAGACA
mlr0015 sufS2 -150 6.6 AGTTTAGAACTATTCAAAACT
mlr4647 PF00033 -32 5.3 AGCTTAGAAATCTTCAAAACT
mlr5523 iprA -244 6.9 AGTTTAGAATAATTCTAAACT
mlr4601 mbfA -35 6.9 AGTTTAGAACAATTCTAAACT
mlr1147 rirA -139 5.1 AGTCTGGAATTGTTCCAAGGT
mll5315 fssA -50 6.2 TATTTAGAACTATTCCAAACT
Brucella melitensis 16M
BMEI1042 sufB -119 4.8 AGTTTAGAGAGGTTTTAAAGA
BMEI0354 mbfA -203 6.6 ATTTTAGAATTATTCTAAATT
BMEII0707 rirA -162 5.6 TTTTAAGAATGATTCTAAAGT
BMEII0885 tpd -137 6 TGTTTAGAATTGATCTAAACT
Bartonella quintana str. Toulouse
BQ01080 ccmA -98 5.2 TTTCTAGAACTATTCTAGATA
BQ05950 sufB -148 5.2 GAATTAGAATTATTTTAAAAA
BQ11660 mbfA -36 6.1 ATCTTAGAATTATTCTAAAGT
Rhodopseudomonas palustris CGA009
RPA2124 hmuR -162 3.9 AAGTTATAATTGCTTTAATCA
RPA4152 fbpA -98 4.2 cGgcTgGAATagTTCTAAtCg
RPA4636 null -79 4.9 CTGTTACAATCGTTCTAAACT
RPA3600 bfr -67 5 GATCTAGAATTATTCTAATTC
RPA4303 mbfA -34 6.1 TATTTAGAAGCGTTCTAAACT
RPA2121 hmuP -87 3.8 CGTTTATAGTAATTATAAGAC
RPA3876 fumA -82 3.8 CCCTTAGAGGTATACTAAATG
RPA1876 fhuA -223 5.5 TGATTTGAACGATTCAAAAAT
RPA3195 iorAB -74 5.3 AGCTTAGACTGGTTCGAAACA
Bradyrhizobium japonicum USDA 110
blr3904 fiu -184 4.9 GTTTTAGAACGACTCCAATTT
bll2737 coxS -52 5.1 TGATTTGAACAGTTCCAATTT
bll7968 fhuA3 -116 5.1 CGCTTAGAACCATTCAACACT
bsr6522 null -79 5 ACTTTAAAATCACTCTAAGGT
blr3904 fiu -162 5.7 ACTTTAGAACCGTTTGAAACT
blr3904 fiu -139 4.9 AGATTAGAATCGTTTTGATCT
bll7076 hmuR -167 4.7 AATTTACAATCGATATAAACT
bll6680 bfr -62 5.7 CATTTAGAAGCGTTCTAAATT
blr7895 mbfA -38 6.7 AATTTAGAATCATTCTAAACT
bsl6681 bfd -96 4.9 AGTTTGGAATAGCTTCAAATA
bsl6681 bfd -128 5.2 ATTTTAGAGCCGTTCTAGGCT
blr4504 fhuA1 -169 4.8 CGTCTAGAAGGATTCCAAATC
bll5796 fumA -62 4.6 AGCTTAGAACGCTTCTATGCC
blr7077 hmuT -302 4.7 AGTTTATATCGATTGTAAATT
Bradyrhizobium sp. BTAi1
BBta_6109 feoA -79 5.1 TGTTTAAAATCGCTCTAAGAT
BBta_6243 bfd 94 4.3 AGaTTgGAATAgcTtcAAAag
BBta_0071 null -102 4.3 AGTTTAGGGGCGTTCTAGATC
BBta_7128 mbfA -58 6 ACTTTAGAAGCGTTCTAAACA
BBta_3540 fiu -157 5 TTTTTAGAATTGTTTTGATCT
BBta_3540 fiu -199 4.9 GTTTTAGAACGATTTCAAGTT
Nitrobacter winogradskyi Nb-255
Nwi_0035 null -112 4.6 AGTTTTGAGCCATTCTAGTTG
Nwi_2475 bfr -81 5.9 GATTTAGAAGTATTCTAAATT
Nwi_2476 bfd -100 5.1 AGTTTGGAATAGCTTGAAACA
Azorhizobium caulinodans ORS 571
AZC_1632 hmuR -82 3.9 ACACTGAAACAGTTATAAATA
AZC_0183 cbrA -155 5.1 TGTTTGGAATAAATCGAAAAA
AZC_1578 hmuP -77 5 AATATTGAATCGCTCTAAAGT
AZC_4058 PF00033 -38 5.2 AGTCTGGACCGGTTCTAAACA
AZC_1626 fhuA -53 5.3 AGATTTGAATACTTCTGAACT
AZC_2246 bfr -66 5.3 AGTTTGGAATTGGTCTAATTA
AZC_1578 hmuP -17 5 AGTTTGGAGTCATTCAAATGA
AZC_4085 mbfA -36 5.6 AAATTAGAAGAGTTCTAAAAA
AZC_4385 hmuT -65 3.7 CAAGTTGATTACCTCTAAACT
AZC_3616 sufS2 -99 6 TATTTAGAATAATTCTAATGT
Xanthobacter autotrophicus Py2
Xaut_4550 hmuP -19 4.5 GATCTGGAGCGATTCAAAAAT
Xaut_4470 sufS2 -158 6 GATTTAGAATAATTCTAATCT
Xaut_4550 hmuP -78 5.7 AGTATTGAATACTTCTAAACT
Xaut_3198 ftr1 -238 5.5 TGATTTGAACAATTCAAAACA
Xaut_3764 fbpA -149 4.5 TAATTGGAACGATTTCAAAGA
Xaut_1186 PF00033 -8 5.2 TTTTTAGAATGAATCAAAATA
Xaut_4191 hmuR -221 4.6 AGTTTTGATTTTTTCAAAGTT
Xaut_3766 bfd -34 4.7 TTTTTAGAAGCTTTCCAATTT
Xaut_2011 mbfA -34 5.3 ATATTAGAAATATTCTAATTT
Xaut_4192 hmuT -56 4.6 AACTTTGAAAAAATCAAAACT
Xaut_3198 ftr1 -125 4.8 GTTTTGGAAATGTTCAAATCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD