Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Desulfuromonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Desulfuromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Geobacter metallireducens GS-15
Gmet_0991 iscU -62 6.4 ATACCTGACAATTTTGCTATAGTAT
Gmet_0870 cysE -138 7.1 ATAGTTGACAGATTTTGTAAGGTAT
Geobacter sulfurreducens PCA
GSU2012 iscU -59 6.4 ATACCTGACAATTTTGCTATAGTAT
GSU2572 cysE -130 6.5 GAAGTTGACAAAAATTGTAGGGTAT
Geobacter uraniumreducens Rf4
Gura_1495 cysE -75 7.1 ATAATTGACTAAAATAGTAAGGTAT
Geobacter sp. FRC-32
Geob_1982 cysE -69 7 ATAATTGACTGAAATAGTAAGGTAT
Pelobacter carbinolicus str. DSM 2380
Pcar_1862 cysE -76 6.5 ATAGTTGACAAAAATGATCAGGCAT
Desulfuromonas acetoxidans DSM 684
Dace_1031 cysE -47 6 ATAGTTGACAGTTATGCTCAGGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD